National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10334R-2 
 Symbol spi  Full Name spitz 
 CG No CG10334  Old CG No CG10334 
 Synonyms spi, CG10334, EP(2)2378, CT29014, Spitz, l(2)01068, Spi, l(2)s3547, l(2)37Fa, anon-WO0118547.158, s-spi 
 Accession No (Link to NCBI) NM_134291.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Wang C, Guo X, Xi R.
EGFR and Notch signaling respectively regulate proliferative activity and multiple cell lineage differentiation of Drosophila gastric stem cells.
Cell Res. (2014) 24(5) 610-27 [ PubMed ID = 24603358 ] [ RRC reference ]

Xu N, Wang SQ, Tan D, Gao Y, Lin G, Xi R.
EGFR, Wingless and JAK/STAT signaling cooperatively maintain Drosophila intestinal stem cells.
Dev. Biol. (2011) 354(1) 31-43 [ PubMed ID = 21440535 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCGCTCTTCGATCTCCTCGT 
 Primer Seq. 3'
aatctagaggtaccGCCATCTGGACAGCACCGGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCGCTCTTC GATCTCCTCG TCCATGTCCG GCACgGCATT GCCGCCGACC CAGGCTCCAG 
0061 TCACTAGTAG CACCACAATG CGCACCACCA CGACGACCAC GCCCAGGCCC AATATTACAT 
0121 TCCCCACATA CAAATGTCCG GAAACCTTCG ATGCCTGGTA CTGTCTGAAC GATGCCCATT 
0181 GCTTTGCGGT GAAGATAGCC GATCTACCGG TTTACAGCTG CGAGTGCGCG ATTGGCTTTA 
0241 TGGGACAGCG ATGCGANATA CAAGGAGATC GACAATACTT ACCTGCCCAA GAGGCCGCGT 
0301 CCGATGTTGG AGANAGGCGA GCATTGCCAG TGGAGCCATG TGTGCCCTGG TATTTATGCT 
0361 GTTTGTCTGC CTGGCCTTCT ATTTGCGCTT CGAGCAGCGG GCTGCCAAGA AGGCCTACGA 
0421 ACTGGAGCAG GAACTGCAGC AGGAATACGA CGATGACGAC GGCCAGTGCG AGTGCTGCCG 
0481 CAACCGGTGC TGTCCAGATG GC 
 in silico PCR Fragment
0001 CGCGCTCTTC GATCTCCTCG TCCATGTCCG GCACGGCATT GCCGCCGACC CAGGCTCCAG 
0061 TCACTAGTAG CACCACAATG CGCACCACCA CGACGACCAC GCCCAGGCCC AATATTACAT 
0121 TCCCCACATA CAAATGTCCG GAAACCTTCG ATGCCTGGTA CTGTTTGAAC GATGCCCATT 
0181 GCTTTGCGGT GAAGATAGCC GATCTACCGG TTTACAGCTG CGAGTGCGCG ATTGGCTTTA 
0241 TGGGACAGCG ATGCGA-ATA CAAGGAGATC GACAATACTT ACCTGCCCAA GAGGCCGCGT 
0301 CCGATGTTGG AGA-AGGCGA GCATTGCCAG TGGAGCCATG TGTGCCCTGG TATTTATGCT 
0361 GTTTGTCTGC CTGGCCTTCT ATTTGCGCTT CGAGCAGCGG GCTGCCAAGA AGGCCTACGA 
0421 ACTGGAGCAG GAACTGCAGC AGGAATACGA CGATGACGAC GGCCAGTGCG AGTGCTGCCG 
0481 CAACCGGTGC TGTCCAGATG GC 
 Assemble Data

10334R-2.IR_full       1   CGCGCTCTTCGATCTCCTCGTCCATGTCCGGCACGGCATTGCCGCCGACCCAGGCTCCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     1   CGCGCTCTTCGATCTCCTCGTCCATGTCCGGCACGGCATTGCCGCCGACCCAGGCTCCAG 60


10334R-2.IR_full       61  TCACTAGTAGCACCACAATGCGCACCACCACGACGACCACGCCCAGGCCCAATATTACAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     61  TCACTAGTAGCACCACAATGCGCACCACCACGACGACCACGCCCAGGCCCAATATTACAT 120


10334R-2.IR_full       121 TCCCCACATACAAATGTCCGGAAACCTTCGATGCCTGGTACTGTCTGAACGATGCCCATT 180
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
10334R-2.in silico     121 TCCCCACATACAAATGTCCGGAAACCTTCGATGCCTGGTACTGTTTGAACGATGCCCATT 180


10334R-2.IR_full       181 GCTTTGCGGTGAAGATAGCCGATCTACCGGTTTACAGCTGCGAGTGCGCGATTGGCTTTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     181 GCTTTGCGGTGAAGATAGCCGATCTACCGGTTTACAGCTGCGAGTGCGCGATTGGCTTTA 240


10334R-2.IR_full       241 TGGGACAGCGATGCGANATACAAGGAGATCGACAATACTTACCTGCCCAAGAGGCCGCGT 300
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     241 TGGGACAGCGATGCGA-ATACAAGGAGATCGACAATACTTACCTGCCCAAGAGGCCGCGT 300


10334R-2.IR_full       301 CCGATGTTGGAGANAGGCGAGCATTGCCAGTGGAGCCATGTGTGCCCTGGTATTTATGCT 360
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     301 CCGATGTTGGAGA-AGGCGAGCATTGCCAGTGGAGCCATGTGTGCCCTGGTATTTATGCT 360


10334R-2.IR_full       361 GTTTGTCTGCCTGGCCTTCTATTTGCGCTTCGAGCAGCGGGCTGCCAAGAAGGCCTACGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     361 GTTTGTCTGCCTGGCCTTCTATTTGCGCTTCGAGCAGCGGGCTGCCAAGAAGGCCTACGA 420


10334R-2.IR_full       421 ACTGGAGCAGGAACTGCAGCAGGAATACGACGATGACGACGGCCAGTGCGAGTGCTGCCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10334R-2.in silico     421 ACTGGAGCAGGAACTGCAGCAGGAATACGACGATGACGACGGCCAGTGCGAGTGCTGCCG 480


10334R-2.IR_full       481 CAACCGGTGCTGTCCAGATGGC 502
                           ||||||||||||||||||||||
10334R-2.in silico     481 CAACCGGTGCTGTCCAGATGGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057561.4  CG10334-RF, transcript variant F (spi), mRNA 
100   482  NM_134291.3  CG10334-RA, transcript variant A (spi), mRNA 
100   482  NM_001032110.1  CG10334-RG, transcript variant G (spi), mRNA 
100   482  NM_134292.2  CG10334-RE, transcript variant E (spi), mRNA 
100   482  NM_134293.2  CG10334-RB, transcript variant B (spi), mRNA 
100   482  NM_134295.1  CG10334-RD, transcript variant D (spi), mRNA 
100   482  NM_134294.1  CG10334-RC, transcript variant C (spi), mRNA 
0.41   NM_130685.1  CG14420-RA (CG14420), mRNA 
0.2   NM_132668.1  CG15757-RA (CG15757), mRNA 
0.2   12  NM_078681.2  CG32540-RA (CCKLR-17D3), mRNA 
0   11  10  NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   10  NM_167132.1  CG2175-RB, transcript variant B (dec-1), mRNA 
0   10  NM_167133.1  CG2175-RC, transcript variant C (dec-1), mRNA 
0   10  NM_176184.2  CG18250-RC, transcript variant C (Dg), mRNA 
0   NM_136882.2  CG30040-RA (jeb), mRNA 
0   25  NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   25  NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   25  NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   25  NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   25  NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   23  NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   23  NM_001043262.1  CG34157-RE, transcript variant E (Dys), mRNA 
0   22  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_078520.2  CG2212-RA, transcript variant A (sws), mRNA 
0   NM_167141.1  CG2212-RB, transcript variant B (sws), mRNA 
0   NM_140372.1  CG14115-RA (CG14115), mRNA 
0   NM_170325.1  CG31064-RA, transcript variant A (CG31064), mRNA 
0   NM_143288.2  CG31064-RE, transcript variant E (CG31064), mRNA 
0   NM_164429.1  CG31666-RC, transcript variant C (CG31666), mRNA 
0   NM_164428.2  CG31666-RB, transcript variant B (CG31666), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.