National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10315R-2 
 Symbol eIF2B-delta  Full Name eIF2B-delta 
 CG No CG10315  Old CG No CG10315 
 Synonyms CG10315, eIF2Bdelta, eIF2B-delta 
 Accession No (Link to NCBI) NM_137946.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCGAACAGGTGCCACAGACTTTGAAGAGCAAGCACAAGAAGCAAAGGCAACGCAATCGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCGCAACAAACGAAATCGCCTGGAAGACAGCCATTCAACGACACAAGAAACATCAGCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCGACGCCACGAGTGCAATGCCCGGAAATGCTGTGGATCCATTGGCCACGGAGAAGACT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGTGACCAGATAATGGCCGAGCGGGAGGCGAAGAAGCTGGCTAAGCAGGCCAAGAAACAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAAACTGCACCGACTCCTACTGCCGCCACTCCTGCTGTTCTGACCACTCCCTCTGCTCCG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCCACCAAAATCATCACTGAAGTGGAGCAGACCACCATTACCACTAAGCTGACGACCACC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACCACAACAAAGGTGCAGGATGCAGTGGCTTCAAAGACGACTCAGCCAGCTGCGGTAAAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     421 GGCAAGGATGCGGAGGCGGGTGAAAAGACACGCGAGCAGATCAAGGCGGAACGCGAGGCC 480

10315R-2.IR_full       481 AAGAAGGCAGCCAAGAAAGC 500
                           |||||||||||||||||||| silico     481 AAGAAGGCAGCCAAGAAAGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137946.2  CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
96.88   467  NM_166601.1  CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
96.68   466  NM_166602.1  CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_140499.2  CG6876-RA (CG6876), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
0   NM_136171.2  CG16772-RA (CG16772), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_143465.1  CG1973-RA (CG1973), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_142787.1  CG12499-RA (CG12499), mRNA 
0   NM_168947.1  CG7139-RB, transcript variant B (CG7139), mRNA 
0   NM_141121.2  CG7139-RA, transcript variant A (CG7139), mRNA 
0   12  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   10  NM_136593.1  CG8181-RA (CG8181), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_165257.1  CG31790-RA (CG31790), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_058114.3  CG14902-RA (decay), mRNA 
0   NM_079202.2  CG7452-RA (Syx17), mRNA 
0   NM_079792.2  CG5441-RA (dei), mRNA 
0   NM_168084.1  CG11347-RD, transcript variant D (CG11347), mRNA 
0   NM_139643.1  CG11347-RA, transcript variant A (CG11347), mRNA 
0   NM_168083.1  CG11347-RB, transcript variant B (CG11347), mRNA 
0   NM_168085.1  CG11347-RC, transcript variant C (CG11347), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.