National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10315R-1 
 Symbol eIF2B-delta  Full Name eIF2B-delta 
 CG No CG10315  Old CG No CG10315 
 Synonyms CG10315, eIF2Bdelta, eIF2B-delta 
 Accession No (Link to NCBI) NM_137946.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGAACAGGTGCCACAGACT 
 Primer Seq. 3'
aatctagaggtaccGCTTTCTTGGCTGCCTTCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCGAACAGG TGCCACAGAC TTTGAAGAGC AAGCACAAGA AGCAAAGGCA ACGCAATCGA 
0061 CCGCGCAACA AACGAAATCG CCTGGAAGAC AGCCATTCAA CGACACAAGA AACATCAGCC 
0121 ATCGACGCCA CGAGTGCAAT GCCCGGAAAT GCTGTGGATC CATTGGCCAC GGAGAAGACT 
0181 CGTGACCAGA TAATGGCCGA GCGGGAGGCG AAGAAGCTGG CTAAGCAGGC CAAGAAACAG 
0241 AAAACTGCAC CGACTCCTAC TGCCGCCACT CCTGCTGTTC TGACCACTCC CTCTGCTCCG 
0301 GCCACCAAAA TCATCACTGA AGTGGAGCAG ACCACCATTA CCACTAAGCT GACGACCACC 
0361 ACCACAACAA AGGTGCAGGA TGCAGTGGCT TCAAAGACGA CTCAGCCAGC TGCGGTAAAT 
0421 GGCAAGGATG CGGAGGCGGG TGAAAAGACA CGCGAGCAGA TCAAgGNGGA ACgCGAGGCC 
0481 AAGAAGGCAG CCAAGAAAGC  
 in silico PCR Fragment
0001 AGCGAACAGG TGCCACAGAC TTTGAAGAGC AAGCACAAGA AGCAAAGGCA ACGCAATCGA 
0061 CCGCGCAACA AACGAAATCG CCTGGAAGAC AGCCATTCAA CGACACAAGA AACATCAGCC 
0121 ATCGACGCCA CGAGTGCAAT GCCCGGAAAT GCTGTGGATC CATTGGCCAC GGAGAAGACT 
0181 CGTGACCAGA TAATGGCCGA GCGGGAGGCG AAGAAGCTGG CTAAGCAGGC CAAGAAACAG 
0241 AAAACTGCAC CGACTCCTAC TGCCGCCACT CCTGCTGTTC TGACCACTCC CTCTGCTCCG 
0301 GCCACCAAAA TCATCACTGA AGTGGAGCAG ACCACCATTA CCACTAAGCT GACGACCACC 
0361 ACCACAACAA AGGTGCAGGA TGCAGTGGCT TCAAAGACGA CTCAGCCAGC TGCGGTAAAT 
0421 GGCAAGGATG CGGAGGCGGG TGAAAAGACA CGCGAGCAGA TCAAGGCGGA ACGCGAGGCC 
0481 AAGAAGGCAG CCAAGAAAGC  
 Assemble Data

10315R-1.IR_full       1   AGCGAACAGGTGCCACAGACTTTGAAGAGCAAGCACAAGAAGCAAAGGCAACGCAATCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     1   AGCGAACAGGTGCCACAGACTTTGAAGAGCAAGCACAAGAAGCAAAGGCAACGCAATCGA 60


10315R-1.IR_full       61  CCGCGCAACAAACGAAATCGCCTGGAAGACAGCCATTCAACGACACAAGAAACATCAGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     61  CCGCGCAACAAACGAAATCGCCTGGAAGACAGCCATTCAACGACACAAGAAACATCAGCC 120


10315R-1.IR_full       121 ATCGACGCCACGAGTGCAATGCCCGGAAATGCTGTGGATCCATTGGCCACGGAGAAGACT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     121 ATCGACGCCACGAGTGCAATGCCCGGAAATGCTGTGGATCCATTGGCCACGGAGAAGACT 180


10315R-1.IR_full       181 CGTGACCAGATAATGGCCGAGCGGGAGGCGAAGAAGCTGGCTAAGCAGGCCAAGAAACAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     181 CGTGACCAGATAATGGCCGAGCGGGAGGCGAAGAAGCTGGCTAAGCAGGCCAAGAAACAG 240


10315R-1.IR_full       241 AAAACTGCACCGACTCCTACTGCCGCCACTCCTGCTGTTCTGACCACTCCCTCTGCTCCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     241 AAAACTGCACCGACTCCTACTGCCGCCACTCCTGCTGTTCTGACCACTCCCTCTGCTCCG 300


10315R-1.IR_full       301 GCCACCAAAATCATCACTGAAGTGGAGCAGACCACCATTACCACTAAGCTGACGACCACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     301 GCCACCAAAATCATCACTGAAGTGGAGCAGACCACCATTACCACTAAGCTGACGACCACC 360


10315R-1.IR_full       361 ACCACAACAAAGGTGCAGGATGCAGTGGCTTCAAAGACGACTCAGCCAGCTGCGGTAAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10315R-1.in silico     361 ACCACAACAAAGGTGCAGGATGCAGTGGCTTCAAAGACGACTCAGCCAGCTGCGGTAAAT 420


10315R-1.IR_full       421 GGCAAGGATGCGGAGGCGGGTGAAAAGACACGCGAGCAGATCAAGGNGGAACGCGAGGCC 480
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
10315R-1.in silico     421 GGCAAGGATGCGGAGGCGGGTGAAAAGACACGCGAGCAGATCAAGGCGGAACGCGAGGCC 480


10315R-1.IR_full       481 AAGAAGGCAGCCAAGAAAGC 500
                           ||||||||||||||||||||
10315R-1.in silico     481 AAGAAGGCAGCCAAGAAAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137946.2  CG10315-RA, transcript variant A (eIF2B-delta), mRNA 
96.88   467  NM_166601.1  CG10315-RB, transcript variant B (eIF2B-delta), mRNA 
96.68   466  NM_166602.1  CG10315-RC, transcript variant C (eIF2B-delta), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_140499.2  CG6876-RA (CG6876), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
0   NM_136171.2  CG16772-RA (CG16772), mRNA 
0   NM_142963.2  CG6173-RA (kal-1), mRNA 
0   NM_143465.1  CG1973-RA (CG1973), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_142787.1  CG12499-RA (CG12499), mRNA 
0   NM_168947.1  CG7139-RB, transcript variant B (CG7139), mRNA 
0   NM_141121.2  CG7139-RA, transcript variant A (CG7139), mRNA 
0   12  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   10  NM_136593.1  CG8181-RA (CG8181), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_165257.1  CG31790-RA (CG31790), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_058114.3  CG14902-RA (decay), mRNA 
0   NM_079202.2  CG7452-RA (Syx17), mRNA 
0   NM_079792.2  CG5441-RA (dei), mRNA 
0   NM_168084.1  CG11347-RD, transcript variant D (CG11347), mRNA 
0   NM_139643.1  CG11347-RA, transcript variant A (CG11347), mRNA 
0   NM_168083.1  CG11347-RB, transcript variant B (CG11347), mRNA 
0   NM_168085.1  CG11347-RC, transcript variant C (CG11347), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.