National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10293R-1 
 Symbol how  Full Name held out wings 
 CG No CG10293  Old CG No CG10293 
 Synonyms 24B, HOW, How, CG10293, who, Who/How, sci, P62, qkr[93F], stru, qkr, l(3)j5B5, SZ1, anon-EST:Liang-2.39, clone 2.39, l(3)s2612, l(3)j5D5, KH93F, how 
 Accession No (Link to NCBI) NM_079723.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCACTTGCAGCAACAGGCAG 
 Primer Seq. 3'
aatctagaggtaccACCCTTGCCTCGGACCATAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCACTTGCA GCAACAGGCA GCCGCAGCAG TTGTTGCGGT CgNGCAACAG CAGCAGGCTC 
0061 AAGCCCAAGC CCAGGCTCAG GCTCAGGCAC AGCAGCAGCA ACAGGCAGCC GCAGNTGGTG 
0121 GTCCCCATGA CCCCGCAGCA CTTGACCCCA CAGCAGCAGC AGCAGAGCAC ACAGCAGCAT 
0181 CGCCGACTAT CTGGCCCAGT TGCTCAAGGA CCGCAAGCAA CTGGCCGCCT TCCCCAACGT 
0241 CTTCACCCAC GTCGAACGCC TGCTGGACGA AGAANATNTG CACGCGTGCG CGCCTCACTN 
0301 GTTCCAGATC AATGGGGTCA AGAAGGAGCC GCTCACTCTG CCCGAACCCG AGGGCTCTGT 
0361 GGTGACGATG AACGAGAAGG TTTATGTGCC AGTCCGCGAG CATCCAGATT TCAACTTTGT 
0421 CGGTCGCATT TTGGGACCCC GTGGCATGAC CGCCAAGCAA TTGGAACAGG AGACCGGCTG 
0481 CAAGATTATG GTCCGAGGCA AGGGT 
 in silico PCR Fragment
0001 AGCACTTGCA GCAACAGGCA GCCGCAGCAG TTGTTGCGGT CGCGCAACAG CAGCAGGCTC 
0061 AAGCCCAAGC CCAGGCTCAG GCTCAGGCAC AGCAGCAGCA ACAGGC-GCC GCAGGTGGTG 
0121 GTCCCCATGA CCCCGCAGCA CTTGACCCCA CAGCAGCAGC AGCAGAGCAC ACAG-AGCAT 
0181 CGCCGACTAT CTGGCCCAGT TGCTCAAGGA CCGCAAGCAA CTGGCCGCCT TCCCCAACGT 
0241 CTTCACCCAC GTCGAACGCC TGCTGGACGA AGAA-AT-TG CACGCGTGCG CGCCTCACT- 
0301 GTTCCAGATC AATGGGGTCA AGAAGGAGCC GCTCACTCTG CCCGAACCCG AGGGCTCTGT 
0361 GGTGACGATG AACGAGAAGG TTTATGTGCC AGTCCGCGAG CATCCAGATT TCAACTTTGT 
0421 CGGTCGCATT TTGGGACCCC GTGGCATGAC CGCCAAGCAA TTGGAACAGG AGACCGGCTG 
0481 CAAGATTATG GTCCGAGGCA AGGGT 
 Assemble Data

10293R-1.IR_full       1   AGCACTTGCAGCAACAGGCAGCCGCAGCAGTTGTTGCGGTCGNGCAACAGCAGCAGGCTC 60
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
10293R-1.in silico     1   AGCACTTGCAGCAACAGGCAGCCGCAGCAGTTGTTGCGGTCGCGCAACAGCAGCAGGCTC 60


10293R-1.IR_full       61  AAGCCCAAGCCCAGGCTCAGGCTCAGGCACAGCAGCAGCAACAGGCAGCCGCAGNTGGTG 120
                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||
10293R-1.in silico     61  AAGCCCAAGCCCAGGCTCAGGCTCAGGCACAGCAGCAGCAACAGGC-GCCGCAGGTGGTG 120


10293R-1.IR_full       121 GTCCCCATGACCCCGCAGCACTTGACCCCACAGCAGCAGCAGCAGAGCACACAGCAGCAT 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
10293R-1.in silico     121 GTCCCCATGACCCCGCAGCACTTGACCCCACAGCAGCAGCAGCAGAGCACACAG-AGCAT 180


10293R-1.IR_full       181 CGCCGACTATCTGGCCCAGTTGCTCAAGGACCGCAAGCAACTGGCCGCCTTCCCCAACGT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10293R-1.in silico     181 CGCCGACTATCTGGCCCAGTTGCTCAAGGACCGCAAGCAACTGGCCGCCTTCCCCAACGT 240


10293R-1.IR_full       241 CTTCACCCACGTCGAACGCCTGCTGGACGAAGAANATNTGCACGCGTGCGCGCCTCACTN 300
                           |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| 
10293R-1.in silico     241 CTTCACCCACGTCGAACGCCTGCTGGACGAAGAA-AT-TGCACGCGTGCGCGCCTCACT- 300


10293R-1.IR_full       301 GTTCCAGATCAATGGGGTCAAGAAGGAGCCGCTCACTCTGCCCGAACCCGAGGGCTCTGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10293R-1.in silico     301 GTTCCAGATCAATGGGGTCAAGAAGGAGCCGCTCACTCTGCCCGAACCCGAGGGCTCTGT 360


10293R-1.IR_full       361 GGTGACGATGAACGAGAAGGTTTATGTGCCAGTCCGCGAGCATCCAGATTTCAACTTTGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10293R-1.in silico     361 GGTGACGATGAACGAGAAGGTTTATGTGCCAGTCCGCGAGCATCCAGATTTCAACTTTGT 420


10293R-1.IR_full       421 CGGTCGCATTTTGGGACCCCGTGGCATGACCGCCAAGCAATTGGAACAGGAGACCGGCTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10293R-1.in silico     421 CGGTCGCATTTTGGGACCCCGTGGCATGACCGCCAAGCAATTGGAACAGGAGACCGGCTG 480


10293R-1.IR_full       481 CAAGATTATGGTCCGAGGCAAGGGT 505
                           |||||||||||||||||||||||||
10293R-1.in silico     481 CAAGATTATGGTCCGAGGCAAGGGT 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  23  NM_001032032.1  CG10293-RC, transcript variant C (how), mRNA 
100   482  10  22  NM_079723.2  CG10293-RA, transcript variant A (how), mRNA 
100   482  10  22  NM_169992.1  CG10293-RB, transcript variant B (how), mRNA 
1.24   10  67  NM_132584.2  CG32654-RC (CG32654), mRNA 
0.62   48  NM_079504.3  CG1133-RA (opa), mRNA 
0.41   21  56  NM_140744.1  CG6064-RA (TORC), mRNA 
0.41   37  NM_142975.2  CG5669-RA (CG5669), mRNA 
0.41   NM_134317.3  CG12021-RA, transcript variant A (Patj), mRNA 
0.41   NM_167917.2  CG12021-RB, transcript variant B (Patj), mRNA 
0.41   NM_057994.4  CG12021-RC, transcript variant C (Patj), mRNA 
0.2   11  40  124  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0.2   11  40  124  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0.2   36  100  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
0.2   26  113  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0.2   23  82  NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0.2   23  82  NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0.2   75  440  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.2   75  440  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.2   75  440  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.2   60  NM_001032400.1  CG9850-RB, transcript variant B (CG9850), mRNA 
0.2   35  NM_142701.2  CG5874-RA (CG5874), mRNA 
0.2   15  NM_058100.3  CG6521-RA (Stam), mRNA 
0.2   17  71  NM_168096.1  CG32245-RB, transcript variant B (CG32245), mRNA 
0.2   84  NM_079996.2  CG18024-RA (SoxN), mRNA 
0.2   19  NM_206783.1  CG6103-RG, transcript variant G (CrebB-17A), mRNA 
0.2   19  NM_206781.1  CG6103-RF, transcript variant F (CrebB-17A), mRNA 
0.2   19  NM_206782.1  CG6103-RD, transcript variant D (CrebB-17A), mRNA 
0.2   19  NM_206784.1  CG6103-RE, transcript variant E (CrebB-17A), mRNA 
0.2   36  215  NM_168571.2  CG32133-RA (CG32133), mRNA 
0.2   31  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.