National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10274R-2 
 Symbol CG10274  Full Name CG10274 
 CG No CG10274  Old CG No CG10274 
 Synonyms CG10274 
 Accession No (Link to NCBI) NM_139778.2 
 Inserted Chr.
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATACCCGGATTGGCCAAGAAA 
 Primer Seq. 3'
aatctagaggtaccTCGCTACTGTTGGGCTCAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATACCCGNAT TGGCCAAGAA ACTGTGTGTC TGCACTTCGC TGGCCGTGGA GCAGTCGGAT 
0061 GGCTTCCCCA AGTGTCTGTG CNGCGCAATG CTTCAGCCGG CTGGACGATA TGCACGAGTT 
0121 CCAAANAGCT GTGCGTGGAC TCGGTGCAAA AGTTCCAGGA CATGGTGGCC AGGAACGTCT 
0181 TTTGCCCGCC AGCGAGTGCG CAGATGAAAA ACTTTGATTT GCTCAACGTG GCGGGGAACG 
0241 AGCCTGAGCT GGTGGGGCAA GACGAGGAGG ATCGTATCAA CTTCGATCCG CTACTGGATC 
0301 ACAAAATGGA GATGATCGAG AACGAGGAGG ATGTGTTCAA GATGTTGGAG CACGTGGACA 
0361 AGGAGGCCGA GCAGGTGGAG AAGGAAGTGA AGCAAGATGA ATTGGACGCC GCCGATCTGA 
0421 TGACCATCTT TGCCGCGGAA TCCTCGGAGG AGAGCGAAGA AGATATTGAC CAAGATGTGG 
0481 ACTTTGAGCC CAACAGTAGC GA 
 in silico PCR Fragment
0001 ATACCCGGAT TGGCCAAGAA ACTGTGTGTC TGCACTTCGC TGGCCGTGGA GCAGTCGGAT 
0061 GGCTTCCCCA AGTGTCTGTG C-GCGCAATG CTTCAGCCGG CTGGACGATA TGCACGAGTT 
0121 CCAAA-AGCT GTGCGTGGAC TCGGTGCAAA AGTTCCAGGA CATGGTGGCC AGGAACGTCT 
0181 TTTGCCCGCC AGCGAGTGCG CAGATGAAAA ACTTTGATTT GCTCAACGTG GCGGGGAACG 
0241 AGCCTGAGCT GGTGGGGCAG GACGAGGAGG ATCGTATCAA CTTCGATCCG CTACTGGATC 
0301 ACAAAATGGA GATGATCGAG AACGAGGAGG ATGTGTTCAA GATGTTGGAG CACGTGGACA 
0361 AGGAGGCCGA GCAGGTGGAG AAGGAAGTGA AGCAAGATGA ATTGGACGCC GCCGATCTGA 
0421 TGACCATCTT TGCCGCGGAA TCCTCGGAGG AGAGCGAAGA AGATATTGAC CAAGATGTGG 
0481 ACTTTGAGCC CAACAGTAGC GA 
 Assemble Data

10274R-2.IR_full       1   ATACCCGNATTGGCCAAGAAACTGTGTGTCTGCACTTCGCTGGCCGTGGAGCAGTCGGAT 60
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     1   ATACCCGGATTGGCCAAGAAACTGTGTGTCTGCACTTCGCTGGCCGTGGAGCAGTCGGAT 60


10274R-2.IR_full       61  GGCTTCCCCAAGTGTCTGTGCNGCGCAATGCTTCAGCCGGCTGGACGATATGCACGAGTT 120
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     61  GGCTTCCCCAAGTGTCTGTGC-GCGCAATGCTTCAGCCGGCTGGACGATATGCACGAGTT 120


10274R-2.IR_full       121 CCAAANAGCTGTGCGTGGACTCGGTGCAAAAGTTCCAGGACATGGTGGCCAGGAACGTCT 180
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     121 CCAAA-AGCTGTGCGTGGACTCGGTGCAAAAGTTCCAGGACATGGTGGCCAGGAACGTCT 180


10274R-2.IR_full       181 TTTGCCCGCCAGCGAGTGCGCAGATGAAAAACTTTGATTTGCTCAACGTGGCGGGGAACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     181 TTTGCCCGCCAGCGAGTGCGCAGATGAAAAACTTTGATTTGCTCAACGTGGCGGGGAACG 240


10274R-2.IR_full       241 AGCCTGAGCTGGTGGGGCAAGACGAGGAGGATCGTATCAACTTCGATCCGCTACTGGATC 300
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     241 AGCCTGAGCTGGTGGGGCAGGACGAGGAGGATCGTATCAACTTCGATCCGCTACTGGATC 300


10274R-2.IR_full       301 ACAAAATGGAGATGATCGAGAACGAGGAGGATGTGTTCAAGATGTTGGAGCACGTGGACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     301 ACAAAATGGAGATGATCGAGAACGAGGAGGATGTGTTCAAGATGTTGGAGCACGTGGACA 360


10274R-2.IR_full       361 AGGAGGCCGAGCAGGTGGAGAAGGAAGTGAAGCAAGATGAATTGGACGCCGCCGATCTGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     361 AGGAGGCCGAGCAGGTGGAGAAGGAAGTGAAGCAAGATGAATTGGACGCCGCCGATCTGA 420


10274R-2.IR_full       421 TGACCATCTTTGCCGCGGAATCCTCGGAGGAGAGCGAAGAAGATATTGACCAAGATGTGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10274R-2.in silico     421 TGACCATCTTTGCCGCGGAATCCTCGGAGGAGAGCGAAGAAGATATTGACCAAGATGTGG 480


10274R-2.IR_full       481 ACTTTGAGCCCAACAGTAGCGA 502
                           ||||||||||||||||||||||
10274R-2.in silico     481 ACTTTGAGCCCAACAGTAGCGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139778.2  CG10274-RA (CG10274), mRNA 
0.62   15  17  NM_139779.1  CG7386-RA (CG7386), mRNA 
0.41   35  46  42  NM_057956.2  CG10269-RA (D19A), mRNA 
0   26  34  NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_143524.2  CG9743-RA (CG9743), mRNA 
0   NM_132132.1  CG4557-RA (CG4557), mRNA 
0   NM_135108.2  CG11149-RB, transcript variant B (CG11149), mRNA 
0   NM_164657.1  CG11149-RA, transcript variant A (CG11149), mRNA 
0   NM_132479.2  CG1597-RA (CG1597), mRNA 
0   NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0   NM_176185.1  CG8421-RE, transcript variant E (Asph), mRNA 
0   NM_142948.2  CG5410-RE, transcript variant E (Miro), mRNA 
0   NM_170111.1  CG5410-RD, transcript variant D (Miro), mRNA 
0   NM_080512.2  CG5247-RA (Irbp), mRNA 
0   NM_141636.1  CG16777-RA (CG16777), mRNA 
0   NM_001031913.1  CG33714-RA, transcript variant A (CG33714), mRNA 
0   NM_001031912.1  CG33714-RB, transcript variant B (CG33714), mRNA 
0   NM_001031914.1  CG33713-RB, transcript variant B (CG33713), mRNA 
0   NM_001031915.1  CG33713-RA, transcript variant A (CG33713), mRNA 
0   NM_057780.2  CG5330-RA (Nap1), mRNA 
0   NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
0   NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
0   NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
0   NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
0   NM_001014517.1  CG2368-RL, transcript variant L (psq), mRNA 
0   NM_001014520.1  CG2368-RI, transcript variant I (psq), mRNA 
0   NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
0   NM_165790.1  CG2368-RA, transcript variant A (psq), mRNA 
0   NM_206086.1  CG2368-RC, transcript variant C (psq), mRNA 
0   NM_001014518.1  CG2368-RK, transcript variant K (psq), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.