National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10267R-2 
 Symbol CG10267  Full Name CG10267 
 CG No CG10267  Old CG No CG10267 
 Synonyms anon-WO0118547.391, CG10267 
 Accession No (Link to NCBI) NM_141400.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGCAATCTGAACGACAGAG 
 Primer Seq. 3'
aatctagaggtaccTAGGGAGTTTAATCCGCGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAGCAATCT GAACGACAGA GAACACATAC CCGATGGCAT CTGCAAGTCC TGCAAGGTCG 
0061 AACTCAACAT GGCCTACCAG TTTCGCGAGA AGGCGCTGCG CAGAGCAGAT GGAGATTGAG 
0121 GAGTACTGCC GGGAACTGGG CTTGCTGGAC GAATCAGATG TGATGATGAT CAAGGAGGAG 
0181 GACGGCTCGC AGCAGCAATG CGACGAGGAG ATGTACATCC TGGAGGAGAC CACCACCGGG 
0241 GAAGAGGAGC ACCAGGAAGA AAAGGGGCAC GAGGAGTACT TGGAAGTGGA CACCAGCGAT 
0301 CAGCAGGAGT GCATTGGCGN ACACCATCGA GTACTTGGAG GACAACTACA CCATCGAGAT 
0361 GAACTCCGAT CAGACCGAGA TCGTCCTGGA GTCTGAGAAG CAGTACGAAG AGACACCATC 
0421 GCAGCAGTTG GCGCTGCAGG AGGCGGCCAA GGCGAAAGCC TGATAAGGCG CGGCGCGGCC 
0481 GGGTTCGTCG CGGATTAAAC TCCCTA 
 in silico PCR Fragment
0001 ACAGCAATCT GAACGACAGA GAACACATAC CCGATGGCAT CTGCAAGTCC TGCAAGGTCG 
0061 AACTCAACAT GGCCTACCAG TTTCGCGAGA AGGCGCTGCG CA-AGCAGAT GGAGATTGAG 
0121 GAGTACTGCC GGGAACTGGG CTTGCTGGAC GAATCAGATG TGATGATGAT CAAGGAGGAG 
0181 GACGGCTCGC AGCAGCAATG CGACGAGGAG ATGTACATCC TGGAGGAGAC CACCACCGGG 
0241 GAAGAGGAGC ACCAGGAAGA AAAGGGGCAC GAGGAGTACT TGGAAGTGGA CACCAGCGAT 
0301 CAGCAGGAGT GCATTGGCG- ACACCATCGA GTACTTGGAG GACAACTACA CCATCGAGAT 
0361 GAACTCCGAT CAGACCGAGA TCGTCCTGGA GTCTGAGAAG CAGTACGAAG AGACACCATC 
0421 GCAGCAGTTG GCGCTGCAGG AGGCGGCCAA GGC--AAGCC TG--AAGGCG CGGCGCGGCC 
0481 GGGTTCGTCG CGGATTAAAC TCCCTA 
 Assemble Data

10267R-2.IR_full       1   ACAGCAATCTGAACGACAGAGAACACATACCCGATGGCATCTGCAAGTCCTGCAAGGTCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10267R-2.in silico     1   ACAGCAATCTGAACGACAGAGAACACATACCCGATGGCATCTGCAAGTCCTGCAAGGTCG 60


10267R-2.IR_full       61  AACTCAACATGGCCTACCAGTTTCGCGAGAAGGCGCTGCGCAGAGCAGATGGAGATTGAG 120
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
10267R-2.in silico     61  AACTCAACATGGCCTACCAGTTTCGCGAGAAGGCGCTGCGCA-AGCAGATGGAGATTGAG 120


10267R-2.IR_full       121 GAGTACTGCCGGGAACTGGGCTTGCTGGACGAATCAGATGTGATGATGATCAAGGAGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10267R-2.in silico     121 GAGTACTGCCGGGAACTGGGCTTGCTGGACGAATCAGATGTGATGATGATCAAGGAGGAG 180


10267R-2.IR_full       181 GACGGCTCGCAGCAGCAATGCGACGAGGAGATGTACATCCTGGAGGAGACCACCACCGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10267R-2.in silico     181 GACGGCTCGCAGCAGCAATGCGACGAGGAGATGTACATCCTGGAGGAGACCACCACCGGG 240


10267R-2.IR_full       241 GAAGAGGAGCACCAGGAAGAAAAGGGGCACGAGGAGTACTTGGAAGTGGACACCAGCGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10267R-2.in silico     241 GAAGAGGAGCACCAGGAAGAAAAGGGGCACGAGGAGTACTTGGAAGTGGACACCAGCGAT 300


10267R-2.IR_full       301 CAGCAGGAGTGCATTGGCGNACACCATCGAGTACTTGGAGGACAACTACACCATCGAGAT 360
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
10267R-2.in silico     301 CAGCAGGAGTGCATTGGCG-ACACCATCGAGTACTTGGAGGACAACTACACCATCGAGAT 360


10267R-2.IR_full       361 GAACTCCGATCAGACCGAGATCGTCCTGGAGTCTGAGAAGCAGTACGAAGAGACACCATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10267R-2.in silico     361 GAACTCCGATCAGACCGAGATCGTCCTGGAGTCTGAGAAGCAGTACGAAGAGACACCATC 420


10267R-2.IR_full       421 GCAGCAGTTGGCGCTGCAGGAGGCGGCCAAGGCGAAAGCCTGATAAGGCGCGGCGCGGCC 480
                           |||||||||||||||||||||||||||||||||  |||||||  ||||||||||||||||
10267R-2.in silico     421 GCAGCAGTTGGCGCTGCAGGAGGCGGCCAAGGC--AAGCCTG--AAGGCGCGGCGCGGCC 480


10267R-2.IR_full       481 GGGTTCGTCGCGGATTAAACTCCCTA 506
                           ||||||||||||||||||||||||||
10267R-2.in silico     481 GGGTTCGTCGCGGATTAAACTCCCTA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141400.2  CG10267-RA (CG10267), mRNA 
0   NM_141505.2  CG10903-RA (CG10903), mRNA 
0   NM_137392.1  CG6477-RA, transcript variant A (RhoGAP54D), mRNA 
0   NM_167421.1  CG32593-RD, transcript variant D (Flo-2), mRNA 
0   NM_167419.1  CG32593-RC, transcript variant C (Flo-2), mRNA 
0   NM_167417.1  CG32593-RF, transcript variant F (Flo-2), mRNA 
0   NM_167416.1  CG32593-RE, transcript variant E (Flo-2), mRNA 
0   NM_078602.2  CG32593-RB, transcript variant B (Flo-2), mRNA 
0   NM_167415.1  CG32593-RA, transcript variant A (Flo-2), mRNA 
0   NM_078727.2  CG4426-RA (ast), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_168495.1  CG32100-RA (CG32100), mRNA 
0   NM_130729.2  CG2938-RB (CG2938), mRNA 
0   NM_141431.1  CG1105-RA (CG1105), mRNA 
0   NM_137016.3  CG17041-RA, transcript variant A (CG17041), mRNA 
0   NM_165978.1  CG17041-RC, transcript variant C (CG17041), mRNA 
0   NM_165977.1  CG17041-RB, transcript variant B (CG17041), mRNA 
0   NM_130524.2  CG3658-RA (CDC45L), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_079545.2  CG1031-RA (alpha-Est1), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_166533.1  CG6339-RA (rad50), mRNA 
0   11  NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 
0   11  NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_166087.1  CG8153-RC, transcript variant C (mus210), mRNA 
0   NM_057513.3  CG8153-RA, transcript variant A (mus210), mRNA 
0   NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.