National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10262R-2 
 Symbol CG10262  Full Name CG10262 
 CG No CG10262  Old CG No CG10262 
 Synonyms CG10262 
 Accession No (Link to NCBI) NM_136150.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGACAACTCCCACGTTTCGCTGGTGGCCCTAAGTCTGGCTTCGGATTGTTTTGAAAAG 60

                           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     61  TTTCACTGCGATCGCAATGT-CTCGCTGGGCTTGGATCTGAAATCCCTGGGCAAGGTGCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TAAGTGCGCCAATAGCGACGATGCGGTCACCATTAAGGCCGTTGACAGACCGGAGAAGAT 180

                           | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 T-ACGCTCAGCTTCGAGTCGGATGGCAAGGAGCGCACGGCGGACTACGAGCTGAAGCTCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCAATCTGGACCAGGATCACATGGAGATTCCGAAAAAGGACTACACCTGCTTCATCCAGT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCCGTCGTCAGAGTTCGCGCGCATTTGCCGGGACATGAGCATGTTCGACGAGTCCCTGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGATCGCCTGCTCCTCGAAGGGCATCAGGTTCTTGGCCAAGGGAGATCTGGGCACGGCCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACATTCAGCTGAGTGCGGGCACCGCCATGGACGTGAGCATTGAGGTGCAGGA 472

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   452  NM_136150.1  CG10262-RA (CG10262), mRNA 
0.22   NM_132435.1  CG1582-RA (CG1582), mRNA 
0   NM_142394.1  CG16766-RA (CG16766), mRNA 
0   NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_057863.3  CG8418-RA (Ric), mRNA 
0   NM_079085.3  CG3613-RA (qkr58E-1), mRNA 
0   NM_141888.2  CG3313-RA (CG3313), mRNA 
0   NM_135569.2  CG7456-RA (CG7456), mRNA 
0   NM_134961.1  CG10019-RA (CG10019), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_078547.2  CG2979-RA (Yp2), mRNA 
0   18  31  NM_206182.1  CG9193-RB, transcript variant B (mus209), mRNA 
0   18  31  NM_057557.3  CG9193-RA, transcript variant A (mus209), mRNA 
0   NM_175977.1  CG14026-RB, transcript variant B (tkv), mRNA 
0   NM_175976.1  CG14026-RC, transcript variant C (tkv), mRNA 
0   NM_175975.1  CG14026-RA, transcript variant A (tkv), mRNA 
0   NM_140706.1  CG6497-RA (CG6497), mRNA 
0   NM_135757.1  CG5122-RA (CG5122), mRNA 
0   10  NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_140343.2  CG17667-RA, transcript variant A (CG17667), mRNA 
0   NM_168516.1  CG17667-RB, transcript variant B (CG17667), mRNA 
0   NM_166641.1  CG2987-RB, transcript variant B (alpha-catenin-related), mRNA 
0   NM_143816.2  CG2987-RA, transcript variant A (alpha-catenin-related), mRNA 
0   NM_136481.1  CG1550-RA (CG1550), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_170391.1  CG1709-RC, transcript variant C (Vha100-1), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_170393.1  CG1709-RF, transcript variant F (Vha100-1), mRNA 
0   NM_141318.2  CG2104-RA (CG2104), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.