National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10262R-1 
 Symbol CG10262  Full Name CG10262 
 CG No CG10262  Old CG No CG10262 
 Synonyms CG10262 
 Accession No (Link to NCBI) NM_136150.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGACAACTCCCACGTTTCG 
 Primer Seq. 3'
aatctagaggtaccTCCTGCACCTCAATGCTCACG 
 Predicted Fragment Size
470 
 IR fragment full Seq
0001 ATGGACAACT CCCACGTTTC GCTGGTGGCC CTAAGTCTGG CTTCGGATTG TTTTGAAAAG 
0061 TTTCACTGCG ATCGCAATGT CCTCGCTGGG CTTGGATCTG AAATCCCTGG GCAAGGTGCT 
0121 TAAGTGCGCC AATAGCGACG ATGCGGTCAC CATTAAGGCC GTTGACAGAC CGGAGAAGAT 
0181 TNACGCTCAG CTTCGAGTCG GATGGCAAGG AGCGCACGGC GGACTACGAG CTGAAGCTCC 
0241 TCAATCTGGA CCAGGATCAC ATGGAGATTC CGAAAAAGGA CTACACCTGC TTCATCCAGT 
0301 TGCCGTCGTC AGAGTTCGCG CGCATTTGCC GGGACATGAG CATGTTCGAC GAGTCCCTGA 
0361 CGATCGCCTG CTCCTCGAAG GGCATCAGGT TCTTGGCCAA GGGAGATCTG GGCACGGCCA 
0421 ACATTCAGCT GAGTGCGGGC ACCGCCATGG ACGTGAGCAT TGAGGTGCAG GA 
 in silico PCR Fragment
0001 ATGGACAACT CCCACGTTTC GCTGGTGGCC CTAAGTCTGG CTTCGGATTG TTTTGAAAAG 
0061 TTTCACTGCG ATCGCAATGT -CTCGCTGGG CTTGGATCTG AAATCCCTGG GCAAGGTGCT 
0121 TAAGTGCGCC AATAGCGACG ATGCGGTCAC CATTAAGGCC GTTGACAGAC CGGAGAAGAT 
0181 T-ACGCTCAG CTTCGAGTCG GATGGCAAGG AGCGCACGGC GGACTACGAG CTGAAGCTCC 
0241 TCAATCTGGA CCAGGATCAC ATGGAGATTC CGAAAAAGGA CTACACCTGC TTCATCCAGT 
0301 TGCCGTCGTC AGAGTTCGCG CGCATTTGCC GGGACATGAG CATGTTCGAC GAGTCCCTGA 
0361 CGATCGCCTG CTCCTCGAAG GGCATCAGGT TCTTGGCCAA GGGAGATCTG GGCACGGCCA 
0421 ACATTCAGCT GAGTGCGGGC ACCGCCATGG ACGTGAGCAT TGAGGTGCAG GA 
 Assemble Data

10262R-1.IR_full       1   ATGGACAACTCCCACGTTTCGCTGGTGGCCCTAAGTCTGGCTTCGGATTGTTTTGAAAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     1   ATGGACAACTCCCACGTTTCGCTGGTGGCCCTAAGTCTGGCTTCGGATTGTTTTGAAAAG 60


10262R-1.IR_full       61  TTTCACTGCGATCGCAATGTCCTCGCTGGGCTTGGATCTGAAATCCCTGGGCAAGGTGCT 120
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     61  TTTCACTGCGATCGCAATGT-CTCGCTGGGCTTGGATCTGAAATCCCTGGGCAAGGTGCT 120


10262R-1.IR_full       121 TAAGTGCGCCAATAGCGACGATGCGGTCACCATTAAGGCCGTTGACAGACCGGAGAAGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     121 TAAGTGCGCCAATAGCGACGATGCGGTCACCATTAAGGCCGTTGACAGACCGGAGAAGAT 180


10262R-1.IR_full       181 TNACGCTCAGCTTCGAGTCGGATGGCAAGGAGCGCACGGCGGACTACGAGCTGAAGCTCC 240
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     181 T-ACGCTCAGCTTCGAGTCGGATGGCAAGGAGCGCACGGCGGACTACGAGCTGAAGCTCC 240


10262R-1.IR_full       241 TCAATCTGGACCAGGATCACATGGAGATTCCGAAAAAGGACTACACCTGCTTCATCCAGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     241 TCAATCTGGACCAGGATCACATGGAGATTCCGAAAAAGGACTACACCTGCTTCATCCAGT 300


10262R-1.IR_full       301 TGCCGTCGTCAGAGTTCGCGCGCATTTGCCGGGACATGAGCATGTTCGACGAGTCCCTGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     301 TGCCGTCGTCAGAGTTCGCGCGCATTTGCCGGGACATGAGCATGTTCGACGAGTCCCTGA 360


10262R-1.IR_full       361 CGATCGCCTGCTCCTCGAAGGGCATCAGGTTCTTGGCCAAGGGAGATCTGGGCACGGCCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     361 CGATCGCCTGCTCCTCGAAGGGCATCAGGTTCTTGGCCAAGGGAGATCTGGGCACGGCCA 420


10262R-1.IR_full       421 ACATTCAGCTGAGTGCGGGCACCGCCATGGACGTGAGCATTGAGGTGCAGGA 472
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||
10262R-1.in silico     421 ACATTCAGCTGAGTGCGGGCACCGCCATGGACGTGAGCATTGAGGTGCAGGA 472

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   452  NM_136150.1  CG10262-RA (CG10262), mRNA 
0.22   NM_132435.1  CG1582-RA (CG1582), mRNA 
0   NM_142394.1  CG16766-RA (CG16766), mRNA 
0   NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_176581.2  CG33204-RA (CG33204), mRNA 
0   NM_057863.3  CG8418-RA (Ric), mRNA 
0   NM_079085.3  CG3613-RA (qkr58E-1), mRNA 
0   NM_141888.2  CG3313-RA (CG3313), mRNA 
0   NM_135569.2  CG7456-RA (CG7456), mRNA 
0   NM_134961.1  CG10019-RA (CG10019), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_078547.2  CG2979-RA (Yp2), mRNA 
0   18  31  NM_206182.1  CG9193-RB, transcript variant B (mus209), mRNA 
0   18  31  NM_057557.3  CG9193-RA, transcript variant A (mus209), mRNA 
0   NM_175977.1  CG14026-RB, transcript variant B (tkv), mRNA 
0   NM_175976.1  CG14026-RC, transcript variant C (tkv), mRNA 
0   NM_175975.1  CG14026-RA, transcript variant A (tkv), mRNA 
0   NM_140706.1  CG6497-RA (CG6497), mRNA 
0   NM_135757.1  CG5122-RA (CG5122), mRNA 
0   10  NM_078722.2  CG17941-RA (ds), mRNA 
0   NM_140343.2  CG17667-RA, transcript variant A (CG17667), mRNA 
0   NM_168516.1  CG17667-RB, transcript variant B (CG17667), mRNA 
0   NM_166641.1  CG2987-RB, transcript variant B (alpha-catenin-related), mRNA 
0   NM_143816.2  CG2987-RA, transcript variant A (alpha-catenin-related), mRNA 
0   NM_136481.1  CG1550-RA (CG1550), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_170391.1  CG1709-RC, transcript variant C (Vha100-1), mRNA 
0   NM_138200.2  CG12030-RA (CG12030), mRNA 
0   NM_170393.1  CG1709-RF, transcript variant F (Vha100-1), mRNA 
0   NM_141318.2  CG2104-RA (CG2104), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.