National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10260Rb-2 
 Symbol CG10260  Full Name CG10260 
 CG No CG10260  Old CG No CG10260 
 Synonyms EG:BACR7C10.2, PI4K, CG10260 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCCCCTGGCAATCGACTTTT 
 Primer Seq. 3'
aatctagaggtaccCCGTGGCCTTGCACAGGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10260Rb-2.IR full       1   CCCCCCTGGCAATCGANTTTTCGCACTGACCTTGAGCGGNNNNCATAAAACAGACATNNG 60
                            |||||||||||||||| ||||||||||||||||||||||    ||||||||||||||  |
10260Rb-2.in silico     1   CCCCCCTGGCAATCGACTTTTCGCACTGACCTTGAGCGGCGGCCATAAAACAGACATGCG 60


10260Rb-2.IR full       61  TGGGCCANTCANGGGGCGGCGGT--------GCAGACCCTGTTCCGGTATTGTCCGCAGG 120
                            |||||   ||| |||||||||||        |||||||||||||||||||||||||||||
10260Rb-2.in silico     61  TGGGC-GCTCAGGGGGCGGCGGTAAGGCAGTGCAGACCCTGTTCCGGTATTGTCCGCAGG 120


10260Rb-2.IR full       121 AGAATGCTGCCGGAGTGTTTTGCCTGGACACGCGGGCCCAGGATGCCGTAATTGCGCTGG 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-2.in silico     121 AGAATGCTGCCGGAGTGTTTTGCCTGGACACGCGGGCCCAGGATGCCGTAATTGCGCTGG 180


10260Rb-2.IR full       181 GCATTTATTTTCTGGAGGGTGGCTGCCANCACGAGGGCCAGATTGTGCCCTATCTGCTGC 240
                            ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||
10260Rb-2.in silico     181 GCATTTATTTTCTGGAGGGCGGCTGCCAGCACGAGGGCCAGATTGTGCCCTATCTGCTGC 240


10260Rb-2.IR full       241 GTCTGGCCAAGTGNCTGCCGAAGGCGGTCTGGATTGACGATGCCCGGAGCAACAAAGTGG 300
                            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-2.in silico     241 GTCTGGCCAAGTGTCTGCCGAAGGCGGTCTGGATTGACGATGCCCGGAGCAACAAAGTGG 300


10260Rb-2.IR full       301 AACGCGTTCGCATTCCGTCGGCGGAAAAGTTCAGCTTCTGCTTGAACACCCTGCTGTCCG 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-2.in silico     301 AACGCGTTCGCATTCCGTCGGCGGAAAAGTTCAGCTTCTGCTTGAACACCCTGCTGTCCG 360


10260Rb-2.IR full       361 ACATAGCGGCCAAGTGTCCGGATTCGCGCGAGGAGATCATCCTGAATCAGGTGGAAACGC 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-2.in silico     361 ACATAGCGGCCAAGTGTCCGGATTCGCGCGAGGAGATCATCCTGAATCAGGTGGAAACGC 420


10260Rb-2.IR full       421 TGAGCGCGCTGGCCAACATAGTCAAGTCGAGCAGGGACAGCAGCTCCGCACCGCCGCCCA 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-2.in silico     421 TGAGCGCGCTGGCCAACATAGTCAAGTCGAGCAGGGACAGCAGCTCCGCACCGCCGCCCA 480


10260Rb-2.IR full       481 TCATCCTGTGCAAGGCCACGG 501
                            |||||||||||||||||||||
10260Rb-2.in silico     481 TCATCCTGTGCAAGGCCACGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.