National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10260Rb-1 
 Symbol CG10260  Full Name CG10260 
 CG No CG10260  Old CG No CG10260 
 Synonyms EG:BACR7C10.2, PI4K, CG10260 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCCCCTGGCAATCGACTTTT 
 Primer Seq. 3'
aatctagaggtaccCCGTGGCCTTGCACAGGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCCCCCTGGC AATCGANTTT TCGCACTGAC CTTGAGCGGN NNNCATAAAA CAGACATNNG 
0061 TGGGCCANTC ANGGGGCGGC GGTGCAGACC CTGTTCCGGT ATTGTCCGCA GGAGAATGCT 
0121 GCCGGAGTGT TTTGCCTGGA CACGCGGGCC CAGGATGCCG TAATTGCGCT GGGCATTTAT 
0181 TTTCTGGAGG GTGGCTGCCA NCACGAGGGC CAGATTGTGC CCTATCTGCT GCGTCTGGCC 
0241 AAGTGNCTGC CGAAGGCGGT CTGGATTGAC GATGCCCGGA GCAACAAAGT GGAACGCGTT 
0301 CGCATTCCGT CGGCGGAAAA GTTCAGCTTC TGCTTGAACA CCCTGCTGTC CGACATAGCG 
0361 GCCAAGTGTC CGGATTCGCG CGAGGAGATC ATCCTGAATC AGGTGGAAAC GCTGAGCGCG 
0421 CTGGCCAACA TAGTCAAGTC GAGCAGGGAC AGCAGCTCCG CACCGCCGCC CATCATCCTG 
0481 TGCAAGGCCA CGG 
 in silico PCR Fragment
0001 CCCCCCTGGC AATCGACTTT TCGCACTGAC CTTGAGCGGC GGCCATAAAA CAGACATGCG 
0061 TGGGCGCTCA GGGGGCGGCG GTAAGGCAGT GCAGACCCTG TTCCGGTATT GTCCGCAGGA 
0121 GAATGCTGCC GGAGTGTTTT GCCTGGACAC GCGGGCCCAG GATGCCGTAA TTGCGCTGGG 
0181 CATTTATTTT CTGGAGGGCG GCTGCCAGCA CGAGGGCCAG ATTGTGCCCT ATCTGCTGCG 
0241 TCTGGCCAAG TGTCTGCCGA AGGCGGTCTG GATTGACGAT GCCCGGAGCA ACAAAGTGGA 
0301 ACGCGTTCGC ATTCCGTCGG CGGAAAAGTT CAGCTTCTGC TTGAACACCC TGCTGTCCGA 
0361 CATAGCGGCC AAGTGTCCGG ATTCGCGCGA GGAGATCATC CTGAATCAGG TGGAAACGCT 
0421 GAGCGCGCTG GCCAACATAG TCAAGTCGAG CAGGGACAGC AGCTCCGCAC CGCCGCCCAT 
0481 CATCCTGTGC AAGGCCACGG  
 Assemble Data

10260Rb-1.IR full       1   CCCCCCTGGCAATCGANTTTTCGCACTGACCTTGAGCGGNNNNCATAAAACAGACATNNG 60
                            |||||||||||||||| ||||||||||||||||||||||    ||||||||||||||  |
10260Rb-1.in silico     1   CCCCCCTGGCAATCGACTTTTCGCACTGACCTTGAGCGGCGGCCATAAAACAGACATGCG 60


10260Rb-1.IR full       61  TGGGCCANTCANGGGGCGGCGGT--------GCAGACCCTGTTCCGGTATTGTCCGCAGG 120
                            |||||   ||| |||||||||||        |||||||||||||||||||||||||||||
10260Rb-1.in silico     61  TGGGC-GCTCAGGGGGCGGCGGTAAGGCAGTGCAGACCCTGTTCCGGTATTGTCCGCAGG 120


10260Rb-1.IR full       121 AGAATGCTGCCGGAGTGTTTTGCCTGGACACGCGGGCCCAGGATGCCGTAATTGCGCTGG 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-1.in silico     121 AGAATGCTGCCGGAGTGTTTTGCCTGGACACGCGGGCCCAGGATGCCGTAATTGCGCTGG 180


10260Rb-1.IR full       181 GCATTTATTTTCTGGAGGGTGGCTGCCANCACGAGGGCCAGATTGTGCCCTATCTGCTGC 240
                            ||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||
10260Rb-1.in silico     181 GCATTTATTTTCTGGAGGGCGGCTGCCAGCACGAGGGCCAGATTGTGCCCTATCTGCTGC 240


10260Rb-1.IR full       241 GTCTGGCCAAGTGNCTGCCGAAGGCGGTCTGGATTGACGATGCCCGGAGCAACAAAGTGG 300
                            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-1.in silico     241 GTCTGGCCAAGTGTCTGCCGAAGGCGGTCTGGATTGACGATGCCCGGAGCAACAAAGTGG 300


10260Rb-1.IR full       301 AACGCGTTCGCATTCCGTCGGCGGAAAAGTTCAGCTTCTGCTTGAACACCCTGCTGTCCG 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-1.in silico     301 AACGCGTTCGCATTCCGTCGGCGGAAAAGTTCAGCTTCTGCTTGAACACCCTGCTGTCCG 360


10260Rb-1.IR full       361 ACATAGCGGCCAAGTGTCCGGATTCGCGCGAGGAGATCATCCTGAATCAGGTGGAAACGC 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-1.in silico     361 ACATAGCGGCCAAGTGTCCGGATTCGCGCGAGGAGATCATCCTGAATCAGGTGGAAACGC 420


10260Rb-1.IR full       421 TGAGCGCGCTGGCCAACATAGTCAAGTCGAGCAGGGACAGCAGCTCCGCACCGCCGCCCA 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10260Rb-1.in silico     421 TGAGCGCGCTGGCCAACATAGTCAAGTCGAGCAGGGACAGCAGCTCCGCACCGCCGCCCA 480


10260Rb-1.IR full       481 TCATCCTGTGCAAGGCCACGG 501
                            |||||||||||||||||||||
10260Rb-1.in silico     481 TCATCCTGTGCAAGGCCACGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.