National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10066R-7 
 Symbol Fer1  Full Name 48 related 1 
 CG No CG33323  Old CG No CG10066 
 Synonyms CG10066, CG33323, BcDNA:RH30329, CG14611, Fer1 
 Accession No (Link to NCBI) NM_206455.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAATTTCGACTTGGAGGCCAC 
 Primer Seq. 3'
aatctagaggtaccGGATAATTTTCTTGGGCGGCT 
 Predicted Fragment Size
476 
 IR fragment full Seq
0001 CAATTTCGAC TTGGAGGCCA CGATGGCGCG CCACTTCTTC GAGGGATCGC AGGCCACCAA 
0061 CGCCTCCACC TCCAGCTCCG ACTATTTTTT TTGGGGACGA GCACAGCTCG GAGAGCGATG 
0121 ACGAGGACGA TGCCTATAGC AGTGGCTTCA ACAGCGACCA GGAGGAACAC CGAGAAGACC 
0181 CGGCGGAGCC ACAAGCCCCG GCGCTTGAAG TGCGCCTCCC AAATGGCCCA GCAGCGGCAG 
0241 GCGGCCAATC TCCGCGAGCG CCGCCGGATG CAGAGCATCA ACGAGGCGTT CGAGGGTCTG 
0301 CGCACCCACA TTCCCACGCT GCCCTACGAG AAGCGACTAA GCAAGGTGGA CACACTCAAG 
0361 CTGGCCATAA GCTACATAAC CTTCCTCAGC GAGATGGTCA AGAAGGACAA GAACGGCAAC 
0421 GAGCCGGGCC TAAGTCTGCA GCGTAACTAC CAAAAGGAGC CGCCCAAGAA AATTATCC 
 in silico PCR Fragment
0001 CAATTTCGAC TTGGAGGCCA CGATGGCGCG CCACTTCTTC GAGGGATCGC AGGCCACCAA 
0061 CGCCTCCACC TCCAGCTCCG ACTA-TTTTT TTGGGGACGA GCACAGCTCG GAGAGCGATG 
0121 ACGAGGACGA TGCCTATAGC AGTGGCTTCA ACAGCGACCA GGA-GAACAC CGAGAAGACC 
0181 CGGCGGAGCC ACAAGCCCCG GCGCTTGAAG TGCGCCTCCC AAATGGCCCA GCAGCGGCAG 
0241 GCGGCCAATC TCCGCGAGCG CCGCCGGATG CAGAGCATCA ACGAGGCGTT CGAGGGTCTG 
0301 CGCACCCACA TTCCCACGCT GCCCTACGAG AAGCGACTAA GCAAGGTGGA CACACTCAAG 
0361 CTGGCCATAA GCTACATAAC CTTCCTCAGC GAGATGGTCA AGAAGGACAA GAACGGCAAC 
0421 GAGCCGGGCC TAAGTCTGCA GCGTAACTAC CAAAAGGAGC CGCCCAAGAA AATTATCC 
 Assemble Data

10066R-7.IR_full       1   CAATTTCGACTTGGAGGCCACGATGGCGCGCCACTTCTTCGAGGGATCGCAGGCCACCAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10066R-7.in silico     1   CAATTTCGACTTGGAGGCCACGATGGCGCGCCACTTCTTCGAGGGATCGCAGGCCACCAA 60


10066R-7.IR_full       61  CGCCTCCACCTCCAGCTCCGACTATTTTTTTTGGGGACGAGCACAGCTCGGAGAGCGATG 120
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
10066R-7.in silico     61  CGCCTCCACCTCCAGCTCCGACTA-TTTTTTTGGGGACGAGCACAGCTCGGAGAGCGATG 120


10066R-7.IR_full       121 ACGAGGACGATGCCTATAGCAGTGGCTTCAACAGCGACCAGGAGGAACACCGAGAAGACC 180
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
10066R-7.in silico     121 ACGAGGACGATGCCTATAGCAGTGGCTTCAACAGCGACCAGGA-GAACACCGAGAAGACC 180


10066R-7.IR_full       181 CGGCGGAGCCACAAGCCCCGGCGCTTGAAGTGCGCCTCCCAAATGGCCCAGCAGCGGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10066R-7.in silico     181 CGGCGGAGCCACAAGCCCCGGCGCTTGAAGTGCGCCTCCCAAATGGCCCAGCAGCGGCAG 240


10066R-7.IR_full       241 GCGGCCAATCTCCGCGAGCGCCGCCGGATGCAGAGCATCAACGAGGCGTTCGAGGGTCTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10066R-7.in silico     241 GCGGCCAATCTCCGCGAGCGCCGCCGGATGCAGAGCATCAACGAGGCGTTCGAGGGTCTG 300


10066R-7.IR_full       301 CGCACCCACATTCCCACGCTGCCCTACGAGAAGCGACTAAGCAAGGTGGACACACTCAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10066R-7.in silico     301 CGCACCCACATTCCCACGCTGCCCTACGAGAAGCGACTAAGCAAGGTGGACACACTCAAG 360


10066R-7.IR_full       361 CTGGCCATAAGCTACATAACCTTCCTCAGCGAGATGGTCAAGAAGGACAAGAACGGCAAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10066R-7.in silico     361 CTGGCCATAAGCTACATAACCTTCCTCAGCGAGATGGTCAAGAAGGACAAGAACGGCAAC 420


10066R-7.IR_full       421 GAGCCGGGCCTAAGTCTGCAGCGTAACTACCAAAAGGAGCCGCCCAAGAAAATTATCC 478
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10066R-7.in silico     421 GAGCCGGGCCTAAGTCTGCAGCGTAACTACCAAAAGGAGCCGCCCAAGAAAATTATCC 478

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   458  NM_206455.1  CG33323-RA (Fer1), mRNA 
0.87   NM_132240.2  CG10965-RA (Corp), mRNA 
0.43   NM_140059.2  CG3448-RB (CG3448), mRNA 
0.21   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_133112.1  CG7349-RA (CG7349), mRNA 
0   NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_170485.1  CG2139-RC, transcript variant C (aralar1), mRNA 
0   NM_170487.1  CG2139-RB, transcript variant B (aralar1), mRNA 
0   NM_143538.2  CG2139-RA, transcript variant A (aralar1), mRNA 
0   NM_170486.1  CG2139-RD, transcript variant D (aralar1), mRNA 
0   NM_142457.2  CG7669-RA (CG7669), mRNA 
0   NM_135861.1  CG15287-RA (CG15287), mRNA 
0   NM_164522.1  CG17257-RA, transcript variant A (CG17257), mRNA 
0   NM_134897.2  CG17257-RB, transcript variant B (CG17257), mRNA 
0   NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_165285.1  CG31797-RA (CG31797), mRNA 
0   NM_078498.2  CG4336-RA (rux), mRNA 
0   NM_144393.1  CG18747-RA (CG18747), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_134577.1  CG1529-RA (CG1529), mRNA 
0   NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_132396.1  CG2222-RA (Psf3), mRNA 
0   NM_080049.2  CG11614-RA (nkd), mRNA 
0   NM_057757.3  CG2714-RA, transcript variant A (crm), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.