National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10062R-1 
 Symbol CG10062  Full Name CG10062 
 CG No CG10062  Old CG No CG10062 
 Synonyms anon-WO0140519.226, CG10062 
 Accession No (Link to NCBI) NM_137572.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCATGGCCAACGAGGAGAG 
 Primer Seq. 3'
aatctagaggtaccACGGATGATTCGGTCCCGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCATGGCC AACGAGGGAG AGCGCCGTGG AGTTCCTGCG CGCCGAGGTA GCCAAAGTGG 
0061 AGTCCGAAAT GAGCGACCTT CTGGAGATCG AAGTGGATGT GCAGCAGGCC AGTGGAGCCT 
0121 ACATGCACTG GGAGATGGTC AACATGTATC AGGGCATTCA GAATGTGGTG GTGAAACTCT 
0181 CCGAAAAGAA CTCGACCAAC GAGAATTACC TGCTGATCAA TAGTCACTAC GATTCGGTGC 
0241 CCGGAAGTCC AGGAGCTGGC GATGATGGTT CCATGGTCGT TACCATGTTG GAGGTGATGC 
0301 GTGTGATAGC CAAATCTGGT GATCCACTGG CCCATCCCAT TGTCTTTCTG TTCAATGGAG 
0361 CTGAGGAGAA TCCTCTGCAG GCATCACATG CCTTCATTAC CCAACACAAA TGGGCCAAGA 
0421 ACTGCAAAGC TCTCATCAAC TTGGACTCAG CCGGATCTGG TGGCCGGGAG ATTCTCTTCC 
0481 AGTCGGGACC GAATCATCCG T 
 in silico PCR Fragment
0001 CAGCATGGCC AACGA-GGAG AGCGCCGTGG AGTTCCTGCG CGCCGAGGTA GCCAAAGTGG 
0061 AGTCCGAAAT GAGCGACCTT CTGGAGATCG AAGTGGATGT GCAGCAGGCC AGTGGAGCCT 
0121 ACATGCACTG GGAGATGGTC AACATGTATC AGGGCATTCA GAATGTGGTG GTGAAACTCT 
0181 CCGAAAAGAA CTCGACCAAC GAGAATTACC TGCTGATCAA TAGTCACTAC GATTCGGTGC 
0241 CCGGAAGTCC AGGAGCTGGC GATGATGGTT CCATGGTCGT TACCATGTTG GAGGTGATGC 
0301 GTGTGATAGC CAAATCTGGT GATCCACTGG CCCATCCCAT TGTCTTTCTG TTCAATGGAG 
0361 CTGAGGAGAA TCCTCTGCAG GCATCACATG CCTTCATTAC CCAACACAAA TGGGCCAAGA 
0421 ACTGCAAAGC TCTCATCAAC TTGGACTCAG CCGGATCTGG TGGCCGGGAG ATTCTCTTCC 
0481 AGTCGGGACC GAATCATCCG T 
 Assemble Data

10062R-1.IR_full       1   CAGCATGGCCAACGAGGGAGAGCGCCGTGGAGTTCCTGCGCGCCGAGGTAGCCAAAGTGG 60
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     1   CAGCATGGCCAACGA-GGAGAGCGCCGTGGAGTTCCTGCGCGCCGAGGTAGCCAAAGTGG 60


10062R-1.IR_full       61  AGTCCGAAATGAGCGACCTTCTGGAGATCGAAGTGGATGTGCAGCAGGCCAGTGGAGCCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     61  AGTCCGAAATGAGCGACCTTCTGGAGATCGAAGTGGATGTGCAGCAGGCCAGTGGAGCCT 120


10062R-1.IR_full       121 ACATGCACTGGGAGATGGTCAACATGTATCAGGGCATTCAGAATGTGGTGGTGAAACTCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     121 ACATGCACTGGGAGATGGTCAACATGTATCAGGGCATTCAGAATGTGGTGGTGAAACTCT 180


10062R-1.IR_full       181 CCGAAAAGAACTCGACCAACGAGAATTACCTGCTGATCAATAGTCACTACGATTCGGTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     181 CCGAAAAGAACTCGACCAACGAGAATTACCTGCTGATCAATAGTCACTACGATTCGGTGC 240


10062R-1.IR_full       241 CCGGAAGTCCAGGAGCTGGCGATGATGGTTCCATGGTCGTTACCATGTTGGAGGTGATGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     241 CCGGAAGTCCAGGAGCTGGCGATGATGGTTCCATGGTCGTTACCATGTTGGAGGTGATGC 300


10062R-1.IR_full       301 GTGTGATAGCCAAATCTGGTGATCCACTGGCCCATCCCATTGTCTTTCTGTTCAATGGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     301 GTGTGATAGCCAAATCTGGTGATCCACTGGCCCATCCCATTGTCTTTCTGTTCAATGGAG 360


10062R-1.IR_full       361 CTGAGGAGAATCCTCTGCAGGCATCACATGCCTTCATTACCCAACACAAATGGGCCAAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     361 CTGAGGAGAATCCTCTGCAGGCATCACATGCCTTCATTACCCAACACAAATGGGCCAAGA 420


10062R-1.IR_full       421 ACTGCAAAGCTCTCATCAACTTGGACTCAGCCGGATCTGGTGGCCGGGAGATTCTCTTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10062R-1.in silico     421 ACTGCAAAGCTCTCATCAACTTGGACTCAGCCGGATCTGGTGGCCGGGAGATTCTCTTCC 480


10062R-1.IR_full       481 AGTCGGGACCGAATCATCCGT 501
                           |||||||||||||||||||||
10062R-1.in silico     481 AGTCGGGACCGAATCATCCGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137572.2  CG10062-RA (CG10062), mRNA 
1.24   23  38  NM_137573.2  CG10073-RA (CG10073), mRNA 
1.03   31  37  NM_165888.2  CG30049-RA (CG30049), mRNA 
0.41   13  25  23  NM_165889.1  CG30043-RA (CG30043), mRNA 
0.2   11  25  16  NM_137571.1  CG9416-RA (CG9416), mRNA 
0.2   11  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0.2   10  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0.2   NM_140083.1  CG18179-RA (CG18179), mRNA 
0   12  37  39  NM_165887.1  CG30047-RA (CG30047), mRNA 
0   37  76  NM_137569.3  CG11961-RB, transcript variant B (CG11961), mRNA 
0   37  76  NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   14  52  NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   14  27  NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   19  NM_165890.2  CG13160-RA (CG13160), mRNA 
0   NM_165196.1  CG31739-RA (CG31739), mRNA 
0   22  43  NM_137574.1  CG10081-RA (CG10081), mRNA 
0   15  39  NM_137570.1  CG10051-RA (CG10051), mRNA 
0   NM_142538.1  CG5237-RA (CG5237), mRNA 
0   NM_136912.2  CG13164-RA, transcript variant A (SIP2), mRNA 
0   NM_165873.2  CG13164-RC, transcript variant C (SIP2), mRNA 
0   NM_165874.1  CG13164-RE, transcript variant E (SIP2), mRNA 
0   NM_176152.1  CG13164-RG, transcript variant G (SIP2), mRNA 
0   NM_132607.1  CG4661-RA (CG4661), mRNA 
0   NM_139388.1  CG13930-RA (CG13930), mRNA 
0   NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0   NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0   NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0   NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.