National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10059R-2 
 Symbol MAGE  Full Name MAGE 
 CG No CG10059  Old CG No CG10059 
 Synonyms CG10059, MAGE 
 Accession No (Link to NCBI) NM_141445.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACATCCTTGATCATACCGCCC 
 Primer Seq. 3'
aatctagaggtaccTTGCTCGAATGTGAACTCCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACATCCTTGA TCATACCGCC CAGAAGATTC CCATAAAGGA CAAGGATTTG ATAGCGGTGG 
0061 CTGGGGACAA GAGCGAACTG AAGAANACGC CTGCCGCTGG TCACTAATCT GCTGGCCGAA 
0121 ACATTCGGTA TAATACTAAC CCCACTGGAC GCGACCACCA AGACGTTCAT CTGCACTGCG 
0181 GAGGAGCCGG TGGCCTCCAT TNCANCGAGC TGNACGCCGG CTCAACGGCC GCAGTTCACG 
0241 CTGCTGTATA TTATTCTCAT GTACATCTTN CCTGCGCGGC AACCGCATCG AGGACTCGAA 
0301 ACTGTACGTT ATGCTGGAGA TGCTCAACAT CTATCCAGAC GAAGAACATG GCTACTTCGG 
0361 CCCCAATCTG CGCAAACAGA TCGAGGAGAC GTTTGTGAAG CAACAATATC TGAAGCGGGA 
0421 ACGCTCACAG CTAAGTGCTT ACGATGATTC CAAGACTTTC TTCCTTTGGG GACCACGCGC 
0481 CAAGGCGGAG TTCACATTCG AGCAA 
 in silico PCR Fragment
0001 ACATCCTTGA TCATACCGCC CAGAAGATTC CCATAAAGGA CAAGGATTTG ATAGCGGTGG 
0061 CTGGGGACAA GAGCGAACTG AAGAA-ACGC CTGCCGCTGG TCACTAATCT GCTGGCCGAA 
0121 ACATTCGGTA TAATACTAAC CCCACTGGAC GCGACCACCA AGACGTTCAT CTGCACTGCG 
0181 GAGGAGCCGG TGGCCTCCAT T-CA-CGAGC TG-ACGCCGG CTCAACGGCC GCAGTTCACG 
0241 CTGCTGTATA TTATTCTCAT GTACATCTT- CCTGCGCGGC AACCGCATCG AGGACTCGAA 
0301 ACTGTACGTT ATGCTGGAGA TGCTCAACAT CTATCCAGAC GAAGAACATG GCTACTTCGG 
0361 CCCCAATCTG CGCAAACAGA TCGAGGAGAC GTTTGTGAAG CAACAATATC TGAAGCGGGA 
0421 ACGCTCACAG CTAAGTGCTT ACGATGATTC CAAGACTTTC TTCCTTTGGG GACCACGTGC 
0481 CAAGGCGGAG TTCACATTCG AGCAA 
 Assemble Data

10059R-2.IR_full       1   ACATCCTTGATCATACCGCCCAGAAGATTCCCATAAAGGACAAGGATTTGATAGCGGTGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10059R-2.in silico     1   ACATCCTTGATCATACCGCCCAGAAGATTCCCATAAAGGACAAGGATTTGATAGCGGTGG 60


10059R-2.IR_full       61  CTGGGGACAAGAGCGAACTGAAGAANACGCCTGCCGCTGGTCACTAATCTGCTGGCCGAA 120
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
10059R-2.in silico     61  CTGGGGACAAGAGCGAACTGAAGAA-ACGCCTGCCGCTGGTCACTAATCTGCTGGCCGAA 120


10059R-2.IR_full       121 ACATTCGGTATAATACTAACCCCACTGGACGCGACCACCAAGACGTTCATCTGCACTGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10059R-2.in silico     121 ACATTCGGTATAATACTAACCCCACTGGACGCGACCACCAAGACGTTCATCTGCACTGCG 180


10059R-2.IR_full       181 GAGGAGCCGGTGGCCTCCATTNCANCGAGCTGNACGCCGGCTCAACGGCCGCAGTTCACG 240
                           ||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||
10059R-2.in silico     181 GAGGAGCCGGTGGCCTCCATT-CA-CGAGCTG-ACGCCGGCTCAACGGCCGCAGTTCACG 240


10059R-2.IR_full       241 CTGCTGTATATTATTCTCATGTACATCTTNCCTGCGCGGCAACCGCATCGAGGACTCGAA 300
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
10059R-2.in silico     241 CTGCTGTATATTATTCTCATGTACATCTT-CCTGCGCGGCAACCGCATCGAGGACTCGAA 300


10059R-2.IR_full       301 ACTGTACGTTATGCTGGAGATGCTCAACATCTATCCAGACGAAGAACATGGCTACTTCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10059R-2.in silico     301 ACTGTACGTTATGCTGGAGATGCTCAACATCTATCCAGACGAAGAACATGGCTACTTCGG 360


10059R-2.IR_full       361 CCCCAATCTGCGCAAACAGATCGAGGAGACGTTTGTGAAGCAACAATATCTGAAGCGGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10059R-2.in silico     361 CCCCAATCTGCGCAAACAGATCGAGGAGACGTTTGTGAAGCAACAATATCTGAAGCGGGA 420


10059R-2.IR_full       421 ACGCTCACAGCTAAGTGCTTACGATGATTCCAAGACTTTCTTCCTTTGGGGACCACGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
10059R-2.in silico     421 ACGCTCACAGCTAAGTGCTTACGATGATTCCAAGACTTTCTTCCTTTGGGGACCACGTGC 480


10059R-2.IR_full       481 CAAGGCGGAGTTCACATTCGAGCAA 505
                           |||||||||||||||||||||||||
10059R-2.in silico     481 CAAGGCGGAGTTCACATTCGAGCAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141445.2  CG10059-RA (MAGE), mRNA 
0   NM_134741.2  CG4947-RA (Tgt), mRNA 
0   NM_138105.1  CG13594-RA (CG13594), mRNA 
0   12  NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_080193.3  CG5504-RA, transcript variant A (l(2)tid), mRNA 
0   NM_206210.1  CG5504-RB, transcript variant B (l(2)tid), mRNA 
0   NM_206209.1  CG5504-RC, transcript variant C (l(2)tid), mRNA 
0   NM_139805.1  CG10077-RA, transcript variant A (CG10077), mRNA 
0   NM_169560.1  CG2988-RA (ems), mRNA 
0   NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 
0   NM_140943.2  CG32227-RA (CG32227), mRNA 
0   NM_140761.2  CG7441-RA (CG7441), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_001015251.1  CG40460-PB.3 (CG40460), mRNA 
0   NM_001015249.1  CG40460-PH.3 (CG40460), mRNA 
0   NM_001015248.1  CG40460-PE.3 (CG40460), mRNA 
0   NM_001015246.1  CG40460-PI.3 (CG40460), mRNA 
0   NM_001015250.1  CG40460-PK.3 (CG40460), mRNA 
0   NM_001015252.1  CG40460-PG.3 (CG40460), mRNA 
0   NM_001015247.1  CG40460-PJ.3 (CG40460), mRNA 
0   NM_001015243.1  CG40460-PC.3 (CG40460), mRNA 
0   NM_001015245.1  CG40460-PF.3 (CG40460), partial mRNA 
0   NM_001015244.1  CG40460-PD.3 (CG40460), mRNA 
0   NM_132468.2  CG1394-RA (CG1394), mRNA 
0   NM_139461.1  CG15877-RA (CG15877), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.