National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10059R-1 
 Symbol MAGE  Full Name MAGE 
 CG No CG10059  Old CG No CG10059 
 Synonyms CG10059, MAGE 
 Accession No (Link to NCBI) NM_141445.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACATCCTTGATCATACCGCCCAGAAGATTCCCATAAAGGACAAGGATTTGATAGCGGTGG 60

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     61  CTGGGGACAAGAGCGAACTGAAGAA-ACGCCTGCCGCTGGTCACTAATCTGCTGGCCGAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACATTCGGTATAATACTAACCCCACTGGACGCGACCACCAAGACGTTCATCTGCACTGCG 180

                           ||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||| silico     181 GAGGAGCCGGTGGCCTCCATT-CA-CGAGCTG-ACGCCGGCTCAACGGCCGCAGTTCACG 240

                           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     241 CTGCTGTATATTATTCTCATGTACATCTT-CCTGCGCGGCAACCGCATCGAGGACTCGAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACTGTACGTTATGCTGGAGATGCTCAACATCTATCCAGACGAAGAACATGGCTACTTCGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCCCAATCTGCGCAAACAGATCGAGGAGACGTTTGTGAAGCAACAATATCTGAAGCGGGA 420

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     421 ACGCTCACAGCTAAGTGCTTACGATGATTCCAAGACTTTCTTCCTTTGGGGACCACGTGC 480

10059R-1.IR_full       481 CAAGGCGGAGTTCACATTCGAGCAA 505
                           ||||||||||||||||||||||||| silico     481 CAAGGCGGAGTTCACATTCGAGCAA 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141445.2  CG10059-RA (MAGE), mRNA 
0   NM_134741.2  CG4947-RA (Tgt), mRNA 
0   NM_138105.1  CG13594-RA (CG13594), mRNA 
0   12  NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_080193.3  CG5504-RA, transcript variant A (l(2)tid), mRNA 
0   NM_206210.1  CG5504-RB, transcript variant B (l(2)tid), mRNA 
0   NM_206209.1  CG5504-RC, transcript variant C (l(2)tid), mRNA 
0   NM_139805.1  CG10077-RA, transcript variant A (CG10077), mRNA 
0   NM_169560.1  CG2988-RA (ems), mRNA 
0   NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 
0   NM_140943.2  CG32227-RA (CG32227), mRNA 
0   NM_140761.2  CG7441-RA (CG7441), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_001015251.1  CG40460-PB.3 (CG40460), mRNA 
0   NM_001015249.1  CG40460-PH.3 (CG40460), mRNA 
0   NM_001015248.1  CG40460-PE.3 (CG40460), mRNA 
0   NM_001015246.1  CG40460-PI.3 (CG40460), mRNA 
0   NM_001015250.1  CG40460-PK.3 (CG40460), mRNA 
0   NM_001015252.1  CG40460-PG.3 (CG40460), mRNA 
0   NM_001015247.1  CG40460-PJ.3 (CG40460), mRNA 
0   NM_001015243.1  CG40460-PC.3 (CG40460), mRNA 
0   NM_001015245.1  CG40460-PF.3 (CG40460), partial mRNA 
0   NM_001015244.1  CG40460-PD.3 (CG40460), mRNA 
0   NM_132468.2  CG1394-RA (CG1394), mRNA 
0   NM_139461.1  CG15877-RA (CG15877), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.