National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10057R-1 
 Symbol CG31510  Full Name CG31510 
 CG No CG31510  Old CG No CG10057 
 Synonyms CG10057, CG31510 
 Accession No (Link to NCBI) NM_170203.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCCTAACACCAATGCGAATA 
 Primer Seq. 3'
aatctagaggtaccTGCAGACTGTGGAGCCTTTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCCTAACAC CCAATGCGAA TAATAACAAA AACAGCCAAT CTCCTGCTGT TAAAAATTTG 
0061 CCAATTATAA ACAAAAATGT ACCAAATCAA AATAATAATG CAAACACTAA CGTTGTTAAG 
0121 CAGGCAGCTG GAAATGAAGT TGCAAAAACA CAGCCGACTC AAAATAAAAA ACCTGCAATT 
0181 GGCGTTAAAA CGAAAAGCAC TGCTACCCCT AAGGTAGTAA ATAATCCAAA CACTCAAAAA 
0241 AATTATTCAG AATAGCACAA CAAACATTCA AAAGAATGTG CCAGAAAACA GTCCACCCAA 
0301 TCAAAAGAAT ACATCAGTAA ATAATACGCC TGTTAAGAAA AACACAGGGA ATAATGCACC 
0361 CGTACAAACG AGTGTTCCTA TTATTGGCGC AAACGCGAAG AAAAGACCTA ACCCAAACCC 
0421 GGGAAATATT CAAGCCAAGA AGGCAAATGT GAATGCGGCC AACGCTAATA ACAACTGCTA 
0481 ATAAAAAGGC TCCACAGTCT GCA 
 in silico PCR Fragment
0001 GCCCTAACA- CCAATGCGAA TAATAACAAA AACAGTCAAT CTCCTGCTGT TAAAAATTTG 
0061 CCAATTATAA ACAAAAATGT ACCAAATCAA AATAATAATG CAAACACTAA CGTTGTTAAG 
0121 CAGGCAGCTG GAAATGAAGT TGCAAAAACA CAGCCGACGC AAAATAAAAA ACCTGCAATG 
0181 GGCGGTAAAA CGAAAAGCAC TGCTACCCCT AAGGTAGTAA ATAATCCAAA CACTCAAAAA 
0241 AA-TATTCAG AATAGCACAA CAAACATTCA AAAGAATGTG CCAGAAAACA GTCCACCCAA 
0301 TCAAAAGAAT ACATCAGTAA ATAATACGCC TGTTAAGAAA AACACAGGGA ATAATGCACC 
0361 CGTACAAACG AGTGTTCCTA TTATTGGCGC AAACGCGAAG AAAAGACCTA ACCCAAACCC 
0421 GGGAAATATT CAAGCCAAGA AGGCAAATGT GAATGCGGCC AACGCAAATA AC-ACTGCTA 
0481 ATAAAAAGGC TCCACAGTCT GCA 
 Assemble Data

10057R-1.IR_full       1   GCCCTAACACCCAATGCGAATAATAACAAAAACAGCCAATCTCCTGCTGTTAAAAATTTG 60
                           ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||
10057R-1.in silico     1   GCCCTAACA-CCAATGCGAATAATAACAAAAACAGTCAATCTCCTGCTGTTAAAAATTTG 60


10057R-1.IR_full       61  CCAATTATAAACAAAAATGTACCAAATCAAAATAATAATGCAAACACTAACGTTGTTAAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10057R-1.in silico     61  CCAATTATAAACAAAAATGTACCAAATCAAAATAATAATGCAAACACTAACGTTGTTAAG 120


10057R-1.IR_full       121 CAGGCAGCTGGAAATGAAGTTGCAAAAACACAGCCGACTCAAAATAAAAAACCTGCAATT 180
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| 
10057R-1.in silico     121 CAGGCAGCTGGAAATGAAGTTGCAAAAACACAGCCGACGCAAAATAAAAAACCTGCAATG 180


10057R-1.IR_full       181 GGCGTTAAAACGAAAAGCACTGCTACCCCTAAGGTAGTAAATAATCCAAACACTCAAAAA 240
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
10057R-1.in silico     181 GGCGGTAAAACGAAAAGCACTGCTACCCCTAAGGTAGTAAATAATCCAAACACTCAAAAA 240


10057R-1.IR_full       241 AATTATTCAGAATAGCACAACAAACATTCAAAAGAATGTGCCAGAAAACAGTCCACCCAA 300
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10057R-1.in silico     241 AA-TATTCAGAATAGCACAACAAACATTCAAAAGAATGTGCCAGAAAACAGTCCACCCAA 300


10057R-1.IR_full       301 TCAAAAGAATACATCAGTAAATAATACGCCTGTTAAGAAAAACACAGGGAATAATGCACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10057R-1.in silico     301 TCAAAAGAATACATCAGTAAATAATACGCCTGTTAAGAAAAACACAGGGAATAATGCACC 360


10057R-1.IR_full       361 CGTACAAACGAGTGTTCCTATTATTGGCGCAAACGCGAAGAAAAGACCTAACCCAAACCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10057R-1.in silico     361 CGTACAAACGAGTGTTCCTATTATTGGCGCAAACGCGAAGAAAAGACCTAACCCAAACCC 420


10057R-1.IR_full       421 GGGAAATATTCAAGCCAAGAAGGCAAATGTGAATGCGGCCAACGCTAATAACAACTGCTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||
10057R-1.in silico     421 GGGAAATATTCAAGCCAAGAAGGCAAATGTGAATGCGGCCAACGCAAATAAC-ACTGCTA 480


10057R-1.IR_full       481 ATAAAAAGGCTCCACAGTCTGCA 503
                           |||||||||||||||||||||||
10057R-1.in silico     481 ATAAAAAGGCTCCACAGTCTGCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170203.1  CG31510-RA (CG31510), mRNA 
0   NM_166121.2  CG8291-RB, transcript variant B (CG8291), mRNA 
0   NM_057791.3  CG17348-RA (drl), mRNA 
0   NM_137220.2  CG8291-RA, transcript variant A (CG8291), mRNA 
0   NM_176181.1  CG8291-RC, transcript variant C (CG8291), mRNA 
0   NM_001042820.1  CG34145-RA (CG34145), mRNA 
0   NM_206654.1  CG18009-RA, transcript variant A (Trf2), mRNA 
0   NM_078529.3  CG18009-RD, transcript variant D (Trf2), mRNA 
0   NM_133080.1  CG15042-RA (CG15042), mRNA 
0   NM_206341.1  CG6024-RB, transcript variant B (CG6024), mRNA 
0   NM_140246.1  CG6024-RA, transcript variant A (CG6024), mRNA 
0   NM_132031.1  CG3097-RA (CG3097), mRNA 
0   NM_136491.1  CG14766-RA (CG14766), mRNA 
0   NM_165195.2  CG31991-RC, transcript variant C (mdy), mRNA 
0   NM_139414.1  CG12025-RA (CG12025), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   NM_057549.2  CG10118-RA, transcript variant A (ple), mRNA 
0   NM_057550.3  CG10118-RB, transcript variant B (ple), mRNA 
0   NM_001015080.1  CG40478-PC.3 (CG40478), mRNA 
0   NM_001015078.1  CG40478-PA.3 (CG40478), mRNA 
0   NM_001015079.1  CG40478-PB.3 (CG40478), mRNA 
0   NM_001038722.1  CG40478-RB, transcript variant B (Dyrk3), mRNA 
0   NM_001038724.1  CG40478-RD, transcript variant D (Dyrk3), mRNA 
0   NM_001038721.1  CG40478-RA, transcript variant A (Dyrk3), mRNA 
0   NM_001038723.1  CG40478-RC, transcript variant C (Dyrk3), mRNA 
0   NM_001038725.1  CG40478-RE, transcript variant E (Dyrk3), mRNA 
0   NM_134894.2  CG3542-RA, transcript variant A (CG3542), mRNA 
0   NM_164521.1  CG3542-RB, transcript variant B (CG3542), mRNA 
0   NM_001038750.1  CG34026-RA (CG34026), mRNA 
0   NM_137472.1  CG18540-RA (CG18540), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.