National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10055R-1 
 Symbol CG10055  Full Name CG10055 
 CG No CG10055  Old CG No CG10055 
 Synonyms RE52393, CG10055 
 Accession No (Link to NCBI) NM_141446.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCAGCTGCTGCTGCTTCTTC 
 Primer Seq. 3'
aatctagaggtaccTCAGCTTGTAGGTGCGCTCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCAGCTGCT GCTgCTTCTT CTTCCGCTGG TGAGGTGTTT GGTCAGGAAG CGGGGTCGGG 
0061 GNTTGGCGGA AGNGGAGGCG TTGCATGTGG ATCGCATAAG AAACTGCGAT ATATTCGTTG 
0121 ACGCGCACGA TCTTTATTTC TACGCAGATG TTAAGCTGTA CAAATTCCAC AAGCCGTCGC 
0181 ACCTTCGACT TGCGAGAGCT GAAGACGCTG TTGATAAAGT TCAACACGAC AGAGAATCAC 
0241 TACCAAATTT GCCTGCGCTG TCTGCCCCTA ACAGCGGGTG CCCAGGAAGG ACCCGGTGGA 
0301 GAAAGAGGCG GAGACGGTGG TACGGGGGAT GCAGCCAAGC AGTGGAATAG TCGCAAAGAG 
0361 TACATAGCCG CATTCCTGCA CCTACCCACA CTGAGTGCCA ATTTGCCGGA CAAGCAGCCT 
0421 CTGGTGCAGG AATGGAAACT CAAACGAATC ACCGATCAGT GCCAATTGCA GCTCGACGAC 
0481 CACGAGCGCA CCTACAAGCT GA 
 in silico PCR Fragment
0001 AGCAGCTGCT GCTGCTTCTT CTTCCGCTGG TGAGGAGTTT GGTCAGGAAG CGGGGTCGGG 
0061 G-TTGGCGGA AGCGGAGGCG TTGCATGTGG ATCGCATAAG AAACTGCGAT ATATTCGTTG 
0121 ACGCGCACGA TCTTTATTTC TACGCAGATG TTAAGCTGTA CAAATTCCAC -AGCCGTCGC 
0181 ACCTTCGACT TGCGAGAGCT GAAGACGCTG TTGATAAAGT TCAACACGAC AGAGAATCAC 
0241 TACCAAATTT GCCTGCGCTG TCTGCCCCTA ACAGCGGGTG CCCAGGAAGG ACCCGGTGGA 
0301 GAAAGAGGCG GAGGCGGTGG TACGGGGGAT GCAGCCAAGC AGTGGAATAG TCGCAAAGAG 
0361 TACATAGCCG CATTCCTGCA CCTACCCACA CTGAGTGCCA ATTTGCCGGA CAAGCAGCCT 
0421 CTGGTGCAGG AATGGAAACT CAAACGAATC ACCGATCAGT GCCAATTGCA GCTCGACGAC 
0481 CACGAGCGCA CCTACAAGCT GA 
 Assemble Data

10055R-1.IR_full       1   AGCAGCTGCTGCTGCTTCTTCTTCCGCTGGTGAGGTGTTTGGTCAGGAAGCGGGGTCGGG 60
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
10055R-1.in silico     1   AGCAGCTGCTGCTGCTTCTTCTTCCGCTGGTGAGGAGTTTGGTCAGGAAGCGGGGTCGGG 60


10055R-1.IR_full       61  GNTTGGCGGAAGNGGAGGCGTTGCATGTGGATCGCATAAGAAACTGCGATATATTCGTTG 120
                           | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
10055R-1.in silico     61  G-TTGGCGGAAGCGGAGGCGTTGCATGTGGATCGCATAAGAAACTGCGATATATTCGTTG 120


10055R-1.IR_full       121 ACGCGCACGATCTTTATTTCTACGCAGATGTTAAGCTGTACAAATTCCACAAGCCGTCGC 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
10055R-1.in silico     121 ACGCGCACGATCTTTATTTCTACGCAGATGTTAAGCTGTACAAATTCCAC-AGCCGTCGC 180


10055R-1.IR_full       181 ACCTTCGACTTGCGAGAGCTGAAGACGCTGTTGATAAAGTTCAACACGACAGAGAATCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10055R-1.in silico     181 ACCTTCGACTTGCGAGAGCTGAAGACGCTGTTGATAAAGTTCAACACGACAGAGAATCAC 240


10055R-1.IR_full       241 TACCAAATTTGCCTGCGCTGTCTGCCCCTAACAGCGGGTGCCCAGGAAGGACCCGGTGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10055R-1.in silico     241 TACCAAATTTGCCTGCGCTGTCTGCCCCTAACAGCGGGTGCCCAGGAAGGACCCGGTGGA 300


10055R-1.IR_full       301 GAAAGAGGCGGAGACGGTGGTACGGGGGATGCAGCCAAGCAGTGGAATAGTCGCAAAGAG 360
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
10055R-1.in silico     301 GAAAGAGGCGGAGGCGGTGGTACGGGGGATGCAGCCAAGCAGTGGAATAGTCGCAAAGAG 360


10055R-1.IR_full       361 TACATAGCCGCATTCCTGCACCTACCCACACTGAGTGCCAATTTGCCGGACAAGCAGCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10055R-1.in silico     361 TACATAGCCGCATTCCTGCACCTACCCACACTGAGTGCCAATTTGCCGGACAAGCAGCCT 420


10055R-1.IR_full       421 CTGGTGCAGGAATGGAAACTCAAACGAATCACCGATCAGTGCCAATTGCAGCTCGACGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10055R-1.in silico     421 CTGGTGCAGGAATGGAAACTCAAACGAATCACCGATCAGTGCCAATTGCAGCTCGACGAC 480


10055R-1.IR_full       481 CACGAGCGCACCTACAAGCTGA 502
                           ||||||||||||||||||||||
10055R-1.in silico     481 CACGAGCGCACCTACAAGCTGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141446.1  CG10055-RA (CG10055), mRNA 
0.62   15  NM_142431.1  CG7187-RA, transcript variant A (Ssdp), mRNA 
0.62   15  NM_169794.1  CG7187-RB, transcript variant B (Ssdp), mRNA 
0.62   13  NM_169795.1  CG7187-RC, transcript variant C (Ssdp), mRNA 
0.41   10  10  NM_167373.1  CG32629-RA (CG32629), mRNA 
0.41   10  NM_170155.1  CG31127-RA (Wsck), mRNA 
0.41   22  NM_001014537.1  CG15112-RD, transcript variant D (ena), mRNA 
0.41   22  NM_166329.1  CG15112-RA, transcript variant A (ena), mRNA 
0.41   22  NM_001014536.1  CG15112-RE, transcript variant E (ena), mRNA 
0.41   22  NM_166330.1  CG15112-RC, transcript variant C (ena), mRNA 
0.41   21  NM_142622.1  CG4360-RA (CG4360), mRNA 
0.41   12  NM_132936.2  CG4768-RA (CG4768), mRNA 
0.41   NM_057632.3  CG10072-RA (sgl), mRNA 
0.2   13  NM_168648.1  CG32156-RB, transcript variant B (Mbs), mRNA 
0.2   12  NM_168646.1  CG32156-RC, transcript variant C (Mbs), mRNA 
0.2   10  18  NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0.2   44  NM_078601.2  CG9533-RA (rut), mRNA 
0   12  48  NM_132959.2  CG8949-RA (CG8949), mRNA 
0   21  NM_170350.1  CG12878-RB, transcript variant B (btz), mRNA 
0   18  NM_134510.1  CG12703-RA (CG12703), mRNA 
0   NM_136033.2  CG12750-RA (ncm), mRNA 
0   11  13  NM_167032.1  CG10706-RB, transcript variant B (SK), mRNA 
0   11  13  NM_167031.1  CG10706-RA, transcript variant A (SK), mRNA 
0   11  13  NM_206631.1  CG10706-RF, transcript variant F (SK), mRNA 
0   11  13  NM_167029.1  CG10706-RC, transcript variant C (SK), mRNA 
0   14  NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_001038879.1  CG11303-RB, transcript variant B (TM4SF), mRNA 
0   NM_057900.3  CG11303-RA, transcript variant A (TM4SF), mRNA 
0   13  18  NM_057309.2  CG6534-RA (slou), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.