National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10052R-1 
 Symbol Rx  Full Name Retinal Homeobox 
 CG No CG10052  Old CG No CG10052 
 Synonyms drx, CG10052, DRx, Drx, W60, bk50, PPH17, E97, wom, Rx 
 Accession No (Link to NCBI) NM_166413.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGTTCAGGTGGTGTGGCCAA 
 Primer Seq. 3'
aatctagaggtaccTGCGCAACTGCGTCAGGGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGNTTCAGGT GGTGTGGCCA ACTCGTCCTN CACAGCGGCg GNCAACAATA CCGCCGcCAC 
0061 ATTCCAGCAC ATCTTCGAGC AGCTGGTACA GCAGGGCGGC GGAAACCACA AGCTGCCCCC 
0121 CAAGCAGCTG GNAGCAACTG CGTNCACCTG CTCGGCAACG TGAGGGACGC CAAGAATCTG 
0181 CAGATGATCG TGGAGAAGTT CAAGAATCTG GAGCAGTTCC ACGAGCACTA CGCCNGCCCA 
0241 CCTGGCCAAC AACAACACTG TGATCTCAAC GGAAGATAGC AACGACTTGG TTAAGGATAA 
0301 TGCCAGGAAG TATGGATCTG GTGGACANAc GCTAACGcCC CGCCACACAA TCGATGNCAT 
0361 TCTGGGCCTA AAGAATCGCA ATGGCGCGGC GAATGGCAGT GGCAGGAATC CGGAAACGGT 
0421 CAGCGATGGC TCCGTTGATC CCTCCCTGGG TGACGATGAT GCCACTGATC TACGcNGCGG 
0481 CATGACNCTG ACGCAGTTGC GCA 
 in silico PCR Fragment
0001 CGGTTCAGGT GGTGTGGCCA ACTCGTCCTC CACAGCGGCG GCCAACAATA CCGCCGCCAC 
0061 ATTCCAGCAC ATCTTCGAGC AGCTGGTACA GCAGGGCGGC GGAAACCACA AGCTGCCCCC 
0121 CAAGCAGCTG G-AGCAACTG CGT-CACCTG CTCGGCAACG TGAGGGACGC CAAGAATCTG 
0181 CAGATGATCG TGGAGAAGTT CAAGAATCTG GAGCAGTTCC ACGAGCACTA CGCC-GCCCA 
0241 CCTGGCTAAC AACAACACTG TGATCTCAAC GGAAGATAGC AACGACTTGG TTAAGGATAA 
0301 TGCCAGGAAG TATGGATCTG GTGGACAAAC GCTAACGCCC CGCCACACAA TCGATGCCAT 
0361 TCTGGGCCTA AAGAATCGCA ATGGCGCGGC GAATGGCAGT GGCAGGAATC CGGAAACGGT 
0421 CAGCGATGGC TCCGTTGATC CCTCCCTGGG TGACGATGAT GCCACTGATC TACGCTGCGG 
0481 CATGACCCTG ACGCAGTTGC GCA 
 Assemble Data

10052R-1.IR_full       1   CGNTTCAGGTGGTGTGGCCAACTCGTCCTNCACAGCGGCGGNCAACAATACCGCCGCCAC 60
                           || |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||
10052R-1.in silico     1   CGGTTCAGGTGGTGTGGCCAACTCGTCCTCCACAGCGGCGGCCAACAATACCGCCGCCAC 60


10052R-1.IR_full       61  ATTCCAGCACATCTTCGAGCAGCTGGTACAGCAGGGCGGCGGAAACCACAAGCTGCCCCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10052R-1.in silico     61  ATTCCAGCACATCTTCGAGCAGCTGGTACAGCAGGGCGGCGGAAACCACAAGCTGCCCCC 120


10052R-1.IR_full       121 CAAGCAGCTGGNAGCAACTGCGTNCACCTGCTCGGCAACGTGAGGGACGCCAAGAATCTG 180
                           ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
10052R-1.in silico     121 CAAGCAGCTGG-AGCAACTGCGT-CACCTGCTCGGCAACGTGAGGGACGCCAAGAATCTG 180


10052R-1.IR_full       181 CAGATGATCGTGGAGAAGTTCAAGAATCTGGAGCAGTTCCACGAGCACTACGCCNGCCCA 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
10052R-1.in silico     181 CAGATGATCGTGGAGAAGTTCAAGAATCTGGAGCAGTTCCACGAGCACTACGCC-GCCCA 240


10052R-1.IR_full       241 CCTGGCCAACAACAACACTGTGATCTCAACGGAAGATAGCAACGACTTGGTTAAGGATAA 300
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
10052R-1.in silico     241 CCTGGCTAACAACAACACTGTGATCTCAACGGAAGATAGCAACGACTTGGTTAAGGATAA 300


10052R-1.IR_full       301 TGCCAGGAAGTATGGATCTGGTGGACANACGCTAACGCCCCGCCACACAATCGATGNCAT 360
                           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||
10052R-1.in silico     301 TGCCAGGAAGTATGGATCTGGTGGACAAACGCTAACGCCCCGCCACACAATCGATGCCAT 360


10052R-1.IR_full       361 TCTGGGCCTAAAGAATCGCAATGGCGCGGCGAATGGCAGTGGCAGGAATCCGGAAACGGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10052R-1.in silico     361 TCTGGGCCTAAAGAATCGCAATGGCGCGGCGAATGGCAGTGGCAGGAATCCGGAAACGGT 420


10052R-1.IR_full       421 CAGCGATGGCTCCGTTGATCCCTCCCTGGGTGACGATGATGCCACTGATCTACGCNGCGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
10052R-1.in silico     421 CAGCGATGGCTCCGTTGATCCCTCCCTGGGTGACGATGATGCCACTGATCTACGCTGCGG 480


10052R-1.IR_full       481 CATGACNCTGACGCAGTTGCGCA 503
                           |||||| ||||||||||||||||
10052R-1.in silico     481 CATGACCCTGACGCAGTTGCGCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_164950.1  CG31723-RA (CG31723), mRNA 
0   15  NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   15  NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   10  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_079785.2  CG8346-RA (HLHm3), mRNA 
0   NM_143783.2  CG5824-RA (l(3)07882), mRNA 
0   NM_166311.1  CG15081-RA, transcript variant A (l(2)03709), mRNA 
0   NM_143773.2  CG15081-RB, transcript variant B (l(2)03709), mRNA 
0   NM_166312.1  CG15081-RC, transcript variant C (l(2)03709), mRNA 
0   NM_133033.1  CG12672-RA (CG12672), mRNA 
0   NM_132253.1  CG12116-RA (CG12116), mRNA 
0   NM_165935.1  CG8776-RB, transcript variant B (CG8776), mRNA 
0   NM_165937.1  CG8776-RD, transcript variant D (CG8776), mRNA 
0   NM_165936.1  CG8776-RC, transcript variant C (CG8776), mRNA 
0   NM_165934.1  CG8776-RA, transcript variant A (CG8776), mRNA 
0   NM_136964.2  CG8776-RE, transcript variant E (CG8776), mRNA 
0   NM_079107.2  CG11173-RA (usnp), mRNA 
0   12  NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 
0   NM_168543.1  CG10724-RB, transcript variant B (CG10724), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_057261.2  CG3821-RA (Aats-asp), mRNA 
0   NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_143456.1  CG7592-RA (Obp99b), mRNA 
0   NM_130691.1  CG4116-RA (CG4116), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.