National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10052R-1 
 Symbol Rx  Full Name Retinal Homeobox 
 CG No CG10052  Old CG No CG10052 
 Synonyms drx, CG10052, DRx, Drx, W60, bk50, PPH17, E97, wom, Rx 
 Accession No (Link to NCBI) NM_166413.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           || |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| silico     1   CGGTTCAGGTGGTGTGGCCAACTCGTCCTCCACAGCGGCGGCCAACAATACCGCCGCCAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATTCCAGCACATCTTCGAGCAGCTGGTACAGCAGGGCGGCGGAAACCACAAGCTGCCCCC 120

                           ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| silico     121 CAAGCAGCTGG-AGCAACTGCGT-CACCTGCTCGGCAACGTGAGGGACGCCAAGAATCTG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     181 CAGATGATCGTGGAGAAGTTCAAGAATCTGGAGCAGTTCCACGAGCACTACGCC-GCCCA 240

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCTGGCTAACAACAACACTGTGATCTCAACGGAAGATAGCAACGACTTGGTTAAGGATAA 300

                           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| silico     301 TGCCAGGAAGTATGGATCTGGTGGACAAACGCTAACGCCCCGCCACACAATCGATGCCAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCTGGGCCTAAAGAATCGCAATGGCGCGGCGAATGGCAGTGGCAGGAATCCGGAAACGGT 420

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     421 CAGCGATGGCTCCGTTGATCCCTCCCTGGGTGACGATGATGCCACTGATCTACGCTGCGG 480

10052R-1.IR_full       481 CATGACNCTGACGCAGTTGCGCA 503
                           |||||| |||||||||||||||| silico     481 CATGACCCTGACGCAGTTGCGCA 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0   NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0   NM_164950.1  CG31723-RA (CG31723), mRNA 
0   15  NM_169394.1  CG17230-RB, transcript variant B (CG17230), mRNA 
0   15  NM_141820.1  CG17230-RA, transcript variant A (CG17230), mRNA 
0   10  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_079785.2  CG8346-RA (HLHm3), mRNA 
0   NM_143783.2  CG5824-RA (l(3)07882), mRNA 
0   NM_166311.1  CG15081-RA, transcript variant A (l(2)03709), mRNA 
0   NM_143773.2  CG15081-RB, transcript variant B (l(2)03709), mRNA 
0   NM_166312.1  CG15081-RC, transcript variant C (l(2)03709), mRNA 
0   NM_133033.1  CG12672-RA (CG12672), mRNA 
0   NM_132253.1  CG12116-RA (CG12116), mRNA 
0   NM_165935.1  CG8776-RB, transcript variant B (CG8776), mRNA 
0   NM_165937.1  CG8776-RD, transcript variant D (CG8776), mRNA 
0   NM_165936.1  CG8776-RC, transcript variant C (CG8776), mRNA 
0   NM_165934.1  CG8776-RA, transcript variant A (CG8776), mRNA 
0   NM_136964.2  CG8776-RE, transcript variant E (CG8776), mRNA 
0   NM_079107.2  CG11173-RA (usnp), mRNA 
0   12  NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 
0   NM_168543.1  CG10724-RB, transcript variant B (CG10724), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_057261.2  CG3821-RA (Aats-asp), mRNA 
0   NM_142053.1  CG14366-RA (CG14366), mRNA 
0   NM_143456.1  CG7592-RA (Obp99b), mRNA 
0   NM_130691.1  CG4116-RA (CG4116), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.