National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10050R-3 
 Symbol CG10050  Full Name CG10050 
 CG No CG10050  Old CG No CG10050 
 Synonyms CG10050 
 Accession No (Link to NCBI) NM_141456.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TGGAGGATGACGCGTGGCTGGACCTCGTGGGCATCAGCGCCGATCCGCCCAACAGACGC 59

                           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     61  AACAAGTGCGAGAAATGCAAACGACCCGTGGTTGTTTGCTGGTGCCCGGCTTTACCGCAT 119

                           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     121 CCACCTGAGGCGGTGTCCTCACAGATTGTTATACTGCAACACCCTGCAGAGGAGAAGAGA 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCGCTACGCACTGCACTGATGCTGCAGTTGGGTTTGGAACCGGGAAAATGTGTCGTCTAC 239

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      241 AAGGCAAGCGGTTTCCAAACCATAGAAACCATGCTGATCTGCAGAGGATTTTGGACTCT 298

                           ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| silico     301 CCACAAACACTGCTTCTGTATCCCAGTCGGGACTCGGTCCCACTGGAAGAGGTGGACCAC 358

10050R-3.IR_full       361 AGTGCGGGTCNTTATNC 375
                           |||||||||| |||| | silico     361 AGTGCGGGTCCTTATAC 375

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   359  NM_141456.2  CG10050-RA (CG10050), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_137654.1  CG13436-RA (CG13436), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_137223.1  CG8302-RA (Cyp4aa1), mRNA 
0   NM_135176.2  CG9506-RA (slam), mRNA 
0   NM_137202.2  CG8190-RA (eIF2B-gamma), mRNA 
0   NM_132927.2  CG18358-RA (CG18358), mRNA 
0   NM_164977.1  CG6686-RA, transcript variant A (CG6686), mRNA 
0   NM_135685.2  CG6686-RB, transcript variant B (CG6686), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_142976.2  CG13609-RA (CG13609), mRNA 
0   NM_078955.2  CG3454-RA (Hdc), mRNA 
0   NM_143645.1  CG1976-RA (RhoGAP100F), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_057515.2  CG6518-RA (inaC), mRNA 
0   NM_080223.2  CG3986-RA (Cht4), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_176203.1  CG4945-RC, transcript variant C (CG4945), mRNA 
0   NM_132226.1  CG1583-RA (CG1583), mRNA 
0   NM_176202.1  CG4945-RB, transcript variant B (CG4945), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.