National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10050R-2 
 Symbol CG10050  Full Name CG10050 
 CG No CG10050  Old CG No CG10050 
 Synonyms CG10050 
 Accession No (Link to NCBI) NM_141456.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGAGGATGACGCGTGGCTG 
 Primer Seq. 3'
aatctagaggtaccGTATAAGGACCCGCACTGTGG 
 Predicted Fragment Size
377 
 IR fragment full Seq
0001 NTGGAGGATG ACGCGTGGcT GGACCTCGTG GGCATCAGCG CCGATCCGCC CAACAGACGC 
0061 AACAAGTGCG AGAAATGCAA ACGACCCGTG GTTGTTTgNT GGTGCCCGGC TTTACCGCAT 
0121 CCACCTGAGG CGGTGTCCTC ACAGATTGTT ATACTGCAAC ANCCTGCAGA GGAGAAGAGA 
0181 TCGCTACGCA CTGCACTGAT GCTGCAGTTG GGTTTGGAAC CGGGAAAATG TGTCGTCTAC 
0241 DAAGGCAAGC GGTTTCCAAA CCATAGAAAC CATGCTGATC TGCAGAGGAT TTTGGACTCT 
0301 CCACAAACAC TGCTTCTGTA TNCCAGtNGG GACTCGGTCC CACTGGAAGA GGTGGACCAC 
0361 AGTGCGGGTC NTTATNC 
 in silico PCR Fragment
0001 ATGGAGGATG ACGCGTGGCT GGACCTCGTG GGCATCAGCG CCGATCCGCC CAACAGACGC 
0061 AACAAGTGCG AGAAATGCAA ACGACCCGTG GTTGTTTGCT GGTGCCCGGC TTTACCGCAT 
0121 CCACCTGAGG CGGTGTCCTC ACAGATTGTT ATACTGCAAC ACCCTGCAGA GGAGAAGAGA 
0181 TCGCTACGCA CTGCACTGAT GCTGCAGTTG GGTTTGGAAC CGGGAAAATG TGTCGTCTAC 
0241 AAAGGCAAGC GGTTTCCAAA CCATAGAAAC CATGCTGATC TGCAGAGGAT TTTGGACTCT 
0301 CCACAAACAC TGCTTCTGTA TCCCAGTCGG GACTCGGTCC CACTGGAAGA GGTGGACCAC 
0361 AGTGCGGGTC CTTATAC 
 Assemble Data

10050R-2.IR_full        1   TGGAGGATGACGCGTGGCTGGACCTCGTGGGCATCAGCGCCGATCCGCCCAACAGACGC 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10050R-2.in silico      1   TGGAGGATGACGCGTGGCTGGACCTCGTGGGCATCAGCGCCGATCCGCCCAACAGACGC 59


10050R-2.IR_full       61  AACAAGTGCGAGAAATGCAAACGACCCGTGGTTGTTTGNTGGTGCCCGGCTTTACCGCAT 119
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
10050R-2.in silico     61  AACAAGTGCGAGAAATGCAAACGACCCGTGGTTGTTTGCTGGTGCCCGGCTTTACCGCAT 119


10050R-2.IR_full       121 CCACCTGAGGCGGTGTCCTCACAGATTGTTATACTGCAACANCCTGCAGAGGAGAAGAGA 179
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
10050R-2.in silico     121 CCACCTGAGGCGGTGTCCTCACAGATTGTTATACTGCAACACCCTGCAGAGGAGAAGAGA 179


10050R-2.IR_full       181 TCGCTACGCACTGCACTGATGCTGCAGTTGGGTTTGGAACCGGGAAAATGTGTCGTCTAC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10050R-2.in silico     181 TCGCTACGCACTGCACTGATGCTGCAGTTGGGTTTGGAACCGGGAAAATGTGTCGTCTAC 239


10050R-2.IR_full        241 AAGGCAAGCGGTTTCCAAACCATAGAAACCATGCTGATCTGCAGAGGATTTTGGACTCT 298
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10050R-2.in silico      241 AAGGCAAGCGGTTTCCAAACCATAGAAACCATGCTGATCTGCAGAGGATTTTGGACTCT 298


10050R-2.IR_full       301 CCACAAACACTGCTTCTGTATNCCAGTNGGGACTCGGTCCCACTGGAAGAGGTGGACCAC 358
                           ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||
10050R-2.in silico     301 CCACAAACACTGCTTCTGTATCCCAGTCGGGACTCGGTCCCACTGGAAGAGGTGGACCAC 358


10050R-2.IR_full       361 AGTGCGGGTCNTTATNC 375
                           |||||||||| |||| |
10050R-2.in silico     361 AGTGCGGGTCCTTATAC 375

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   359  NM_141456.2  CG10050-RA (CG10050), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_079044.1  CG17876-RA (Amy-d), mRNA 
0   NM_080421.3  CG18730-RA (Amy-p), mRNA 
0   NM_142889.1  CG4374-RA (CG4374), mRNA 
0   NM_137654.1  CG13436-RA (CG13436), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_137223.1  CG8302-RA (Cyp4aa1), mRNA 
0   NM_135176.2  CG9506-RA (slam), mRNA 
0   NM_137202.2  CG8190-RA (eIF2B-gamma), mRNA 
0   NM_132927.2  CG18358-RA (CG18358), mRNA 
0   NM_164977.1  CG6686-RA, transcript variant A (CG6686), mRNA 
0   NM_135685.2  CG6686-RB, transcript variant B (CG6686), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_142976.2  CG13609-RA (CG13609), mRNA 
0   NM_078955.2  CG3454-RA (Hdc), mRNA 
0   NM_143645.1  CG1976-RA (RhoGAP100F), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_057515.2  CG6518-RA (inaC), mRNA 
0   NM_080223.2  CG3986-RA (Cht4), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_176203.1  CG4945-RC, transcript variant C (CG4945), mRNA 
0   NM_132226.1  CG1583-RA (CG1583), mRNA 
0   NM_176202.1  CG4945-RB, transcript variant B (CG4945), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.