National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1004R-3 
 Symbol rho  Full Name rhomboid 
 CG No CG1004  Old CG No CG1004 
 Synonyms Rho-1, CG1004, Rho1, rhomboid/veinlet, ve, rho1, rho-1, Rho, DMRHOb, RHO, rhom, RHOb, DMRHO, DRORHO, Ve, DMRHOa, rho 
 Accession No (Link to NCBI) NM_079159.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTTCCACCTGGGCTTCAAT 
 Primer Seq. 3'
aatctagaggtaccATCAGGTTGAAAACGATGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTTCCACC TGGGCTTCAA TATCGTCATC CAGCTGTTCT TTGGCATTCC CCTGGAGGTG 
0061 ATGCACGGCA CGGCCAGGAT CGGCGTGATC TACATGGCGG GCGTTTTTGC CGGATCCCTG 
0121 GGCACCAGTG TCGTCGACTC GGAGGTCTTC CTGGTGGGCG CCAGCGGTGG CGTCTATGCC 
0181 CTGTTGGCCG CTCATCTGGC CAACATTACA CTGAACTATG CGCACATGAA GAGCGCATCC 
0241 ACGCAACTCG GATCCGTTGT CATCTTTGTC TCCTGCGATC TGGGCTATGC TCTCTACACC 
0301 CAATACTTCG ATGGAAGCGC CTTCGCCAAG GGTCCCCAGG TGTCGTACAT TGCCCACCTG 
0361 ACGGGAGCCC TGGCAGGACT AACGATCGGC TTCCTGGTGC TAAAGAACTT CGGTCATCGG 
0421 GAGTACGAGC AGCTCATCTG GTGGCTAGCG CTGGGCGTCT ACTGTGCCTT CACCGTCTTC 
0481 GCCATCGTTT TCAACCTGAT  
 in silico PCR Fragment
0001 TGGTTCCACC TGGGCTTCAA TATCGTCATC CAGCTGTTTT TTGGCATTCC CCTGGAGGTG 
0061 ATGCACGGCA CGGCCAGGAT CGGCGTGATC TACATGGCGG GCGTTTTTGC CGGATCCCTG 
0121 GGCACCAGTG TCGTCGACTC GGAGGTCTTC CTGGTGGGCG CCAGCGGTGG CGTCTATGCC 
0181 CTGTTGGCCG CACATCTGGC CAACATTACA CTGAACTATG CGCACATGAA GAGCGCATCC 
0241 ACGCAACTCG GATCCGTTGT CATCTTTGTC TCCTGCGATC TGGGCTATGC TCTCTACACC 
0301 CAATACTTCG ATGGAAGCGC CTTCGCCAAG GGTCCCCAGG TGTCGTACAT TGCCCACCTG 
0361 ACGGGAGCCC TGGCAGGACT AACGATCGGC TTTCTGGTGC TAAAGAACTT CGGTCACCGA 
0421 GAGTACGAGC AGCTCATCTG GTGGCTAGCG TTGGGCGTCT ACTGTGCCTT CACCGTCTTC 
0481 GCCATCGTTT TCAACCTGAT  
 Assemble Data

1004R-3.IR_full       1   TGGTTCCACCTGGGCTTCAATATCGTCATCCAGCTGTTCTTTGGCATTCCCCTGGAGGTG 60
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
1004R-3.in silico     1   TGGTTCCACCTGGGCTTCAATATCGTCATCCAGCTGTTTTTTGGCATTCCCCTGGAGGTG 60


1004R-3.IR_full       61  ATGCACGGCACGGCCAGGATCGGCGTGATCTACATGGCGGGCGTTTTTGCCGGATCCCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1004R-3.in silico     61  ATGCACGGCACGGCCAGGATCGGCGTGATCTACATGGCGGGCGTTTTTGCCGGATCCCTG 120


1004R-3.IR_full       121 GGCACCAGTGTCGTCGACTCGGAGGTCTTCCTGGTGGGCGCCAGCGGTGGCGTCTATGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1004R-3.in silico     121 GGCACCAGTGTCGTCGACTCGGAGGTCTTCCTGGTGGGCGCCAGCGGTGGCGTCTATGCC 180


1004R-3.IR_full       181 CTGTTGGCCGCTCATCTGGCCAACATTACACTGAACTATGCGCACATGAAGAGCGCATCC 240
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
1004R-3.in silico     181 CTGTTGGCCGCACATCTGGCCAACATTACACTGAACTATGCGCACATGAAGAGCGCATCC 240


1004R-3.IR_full       241 ACGCAACTCGGATCCGTTGTCATCTTTGTCTCCTGCGATCTGGGCTATGCTCTCTACACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1004R-3.in silico     241 ACGCAACTCGGATCCGTTGTCATCTTTGTCTCCTGCGATCTGGGCTATGCTCTCTACACC 300


1004R-3.IR_full       301 CAATACTTCGATGGAAGCGCCTTCGCCAAGGGTCCCCAGGTGTCGTACATTGCCCACCTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1004R-3.in silico     301 CAATACTTCGATGGAAGCGCCTTCGCCAAGGGTCCCCAGGTGTCGTACATTGCCCACCTG 360


1004R-3.IR_full       361 ACGGGAGCCCTGGCAGGACTAACGATCGGCTTCCTGGTGCTAAAGAACTTCGGTCATCGG 420
                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || 
1004R-3.in silico     361 ACGGGAGCCCTGGCAGGACTAACGATCGGCTTTCTGGTGCTAAAGAACTTCGGTCACCGA 420


1004R-3.IR_full       421 GAGTACGAGCAGCTCATCTGGTGGCTAGCGCTGGGCGTCTACTGTGCCTTCACCGTCTTC 480
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
1004R-3.in silico     421 GAGTACGAGCAGCTCATCTGGTGGCTAGCGTTGGGCGTCTACTGTGCCTTCACCGTCTTC 480


1004R-3.IR_full       481 GCCATCGTTTTCAACCTGAT 500
                          ||||||||||||||||||||
1004R-3.in silico     481 GCCATCGTTTTCAACCTGAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079159.2  CG1004-RA (rho), mRNA 
0   NM_132478.1  CG11757-RA (CG11757), mRNA 
0   NM_080296.2  CG16785-RA (fz3), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
0   NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   NM_134493.2  CG14214-RA (Sec61gamma), mRNA 
0   NM_137997.2  CG5597-RA (CG5597), mRNA 
0   NM_137971.2  CG5428-RA (CG5428), mRNA 
0   NM_079865.3  CG1480-RA (bnk), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_142157.1  CG6974-RA (CG6974), mRNA 
0   NM_139913.1  CG13681-RA (CG13681), mRNA 
0   NM_141850.2  CG14718-RA (CG14718), mRNA 
0   NM_142834.2  CG6985-RA (CG6985), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_080148.2  CG2522-RA (Gtp-bp), mRNA 
0   NM_079321.2  CG10571-RA (ara), mRNA 
0   NM_136894.1  CG8860-RA (CG8860), mRNA 
0   NM_144381.1  CG15378-RA (lectin-22C), mRNA 
0   NM_164752.2  CG12789-RA, transcript variant A (CG12789), mRNA 
0   NM_135277.2  CG12789-RB, transcript variant B (CG12789), mRNA 
0   NM_080104.2  CG4032-RA (Abl), mRNA 
0   NM_132749.1  CG9521-RA (CG9521), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.