National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10047R-2 
 Symbol SytIV  Full Name Synaptotagmin IV 
 CG No CG10047  Old CG No CG10047 
 Synonyms Syt4, syt4, dsyt4, sytIV, SYT4, D.Syt IV, CG10047, SytIV 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGATGCCAGCGTCATGGACA 
 Primer Seq. 3'
aatctagaggtaccCACGGTCAGCTCCTTCCCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10047R-2.IR full       1   CAGATGCCAGCGTCATGGACACGATTGTCCCCGCCATCCTGGGACTGACTGCGGCTGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10047R-2.in silico     1   CAGATGCCAGCGTCATGGACACGATTGTCCCCGCCATCCTGGGACTGACTGCGGCTGCTG 60


10047R-2.IR full       61  TCCTCTCGTCAGTGGCCTGCATCTGCGCCCGGCAGATGCGCNTCCGGAACAAGAAACAGA 120
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
10047R-2.in silico     61  TCCTCTCGTCAGTGGCCTGCATCTGCGCCCGGCAGATGCGCCTCCGGAACAAGAAACAGA 120


10047R-2.IR full       121 GCCAGCACGACGCCTCGTTCCCCTTCCAGCCGACCCG-CGACCGACCGCCGTTCGATCGC 180
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
10047R-2.in silico     121 GCCAGCACGACGCCTCGTTCCCCTTCCAGCCGACCCGGCGACCGACCGCCGTTCGATCGC 180


10047R-2.IR full       181 CCAGCGGCCAGNCGCCGCACTACTTGAAGAAGTCGCCCTCGCCGACGGGAGGCAAGCAGA 240
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
10047R-2.in silico     181 CCAGCGGCCAGCCGCCGCACTACTTGAAGAAGTCGCCCTCGCCGACGGGAGGCAAGCAGA 240


10047R-2.IR full       241 TGGGACTGCTGTCGCCGATGCAGGACCAGTCCACCTCCCCGATTGCGCAACCGAATGTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10047R-2.in silico     241 TGGGACTGCTGTCGCCGATGCAGGACCAGTCCACCTCCCCGATTGCGCAACCGAATGTCA 300


10047R-2.IR full       301 AGTACAGCGAGGAGGGAGATGGACNCGCCCAGCATGCGGAGCAGCAGAATGGCAATCAAC 360
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
10047R-2.in silico     301 AGTACAGCGAGGAGGGAGATGGACCCGCCCAGCATGCGGAGCAGCAGAATGGCAATCAAC 360


10047R-2.IR full       361 TGACCGTGGTGGATGGTAATGGGTTGAAGCACTCGCTGCACAACAGCCTTCACCACTCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10047R-2.in silico     361 TGACCGTGGTGGATGGTAATGGGTTGAAGCACTCGCTGCACAACAGCCTTCACCACTCGC 420


10047R-2.IR full       421 CGGTAGAGACGATCGCCAACGGAAGTGTGACCATTACCCTGGACGACCATTCGCTGACCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10047R-2.in silico     421 CGGTAGAGACGATCGCCAACGGAAGTGTGACCATTACCCTGGACGACCATTCGCTGACCA 480


10047R-2.IR full       481 ACGGGAAGGAGCTGACCGTG 500
                           ||||||||||||||||||||
10047R-2.in silico     481 ACGGGAAGGAGCTGACCGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.