National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10046Ra-1 
 Symbol bru3  Full Name bruno 3 
 CG No CG43744  Old CG No CG10046 
 Synonyms Bru-3,bru-3,bru3,bruno-3,CG10046,cg10046,CG12478,cg12478,CG34243,CG43744,Dm Bru-3,l(3)05871,bruno3,bruno 3,lethal (3) 05871 
 Accession No (Link to NCBI) NM_168557.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCCTGGTCGTCAAATACGC 
 Primer Seq. 3'
aatctagaggtaccGAAACGGTGGCAGACCAGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCCTGGTC GTCAAATACG CCGACACGGA GAAGGAGCGA CAAATAAGGC GCATGCAGCA 
0061 AATGGCCGGT CACATGAACC TGCTGAATCC GTTCGTCTTT AATCAGTTCA GTCCGTACGG 
0121 CGCCTACGCC CAGCAACAGC AACAGGCCGC TCTGATGGCC GCCGCTGCCA CGGCACCCGG 
0181 ATCCGCAGCC GCCTACATGA ACCCGATGGC GGCTCTGGCA ACGCAGATAC CTCATGGCCT 
0241 AAACGGCACC GGCCAGCCCC CCTCGCTGCC GTCGCCGACC ATGCCCAACT TCAACATGGG 
0301 CGCCAACACG CCCAACGGAC AGCCCGGCGG NNNNNCNGCC GCTGCTGCTG CGGCGNNTGC 
0361 CGCGGACGGC GTCTTTCACG AACGGCATTC CACAAACGGC ATTCCCAGGA CATCCGCTGC 
0421 ACTTGACTAT ACCGCCACAA GGTTTGCCAA ACGGGATGCT GCTACCCTGC AACATGCCTT 
0481 CCCTGGTCTG CCACCGTTTC  
 in silico PCR Fragment
0001 CAGCCTGGTC GTCAAATACG CCGACACGGA GAAGGAGCGA CAAATAAGGC GCATGCAGCA 
0061 AATGGCCGGT CACATGAACC TGCTGAATCC GTTCGTCTTT AATCAGTTCA GTCCGTACGG 
0121 CGCCTACGCC CAGCAACAGC AACAGGCCGC TCTGATGGCC GCCGCTGCCA CGGCACCCGG 
0181 ATCCGCAGCC GCCTACATGA ACCCGATGGC GGCTCTGGCA ACGCAGATAC CTCATGGCCT 
0241 AAACGGCACC GGCCAGCCCC CCTCGCTGCC GTCGCCGACC ATGCCCAACT TCAACATGGG 
0301 CGCCAACACG CCCAACGGAC AGCCCGGCGG AGCGGCCGCC GCTGCTGCTG CGGCGGCTGC 
0361 CGCGGACGGC GTCTTCACGA ACGGCATTCC ACAAACGGCA TTCCCAGGAC ATCCGCTGCA 
0421 CTTGACTATA CCGCCACAAG GTTTGCCAAA CGGCGATGCT GCTACCCTGC AACATGCCTT 
0481 CCCTGGTCTG CCACCGTTTC  
 Assemble Data

10046Ra-1.IR full       1   CAGCCTGGTCGTCAAATACGCCGACACGGAGAAGGAGCGACAAATAAGGCGCATGCAGCA 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10046Ra-1.in silico     1   CAGCCTGGTCGTCAAATACGCCGACACGGAGAAGGAGCGACAAATAAGGCGCATGCAGCA 60


10046Ra-1.IR full       61  AATGGCCGGTCACATGAACCTGCTGAATCCGTTCGTCTTTAATCAGTTCAGTCCGTACGG 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10046Ra-1.in silico     61  AATGGCCGGTCACATGAACCTGCTGAATCCGTTCGTCTTTAATCAGTTCAGTCCGTACGG 120


10046Ra-1.IR full       121 CGCCTACGCCCAGCAACAGCAACAGGCCGCTCTGATGGCCGCCGCTGCCACGGCACCCGG 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10046Ra-1.in silico     121 CGCCTACGCCCAGCAACAGCAACAGGCCGCTCTGATGGCCGCCGCTGCCACGGCACCCGG 180


10046Ra-1.IR full       181 ATCCGCAGCCGCCTACATGAACCCGATGGCGGCTCTGGCAACGCAGATACCTCATGGCCT 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10046Ra-1.in silico     181 ATCCGCAGCCGCCTACATGAACCCGATGGCGGCTCTGGCAACGCAGATACCTCATGGCCT 240


10046Ra-1.IR full       241 AAACGGCACCGGCCAGCCCCCCTCGCTGCCGTCGCCGACCATGCCCAACTTCAACATGGG 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10046Ra-1.in silico     241 AAACGGCACCGGCCAGCCCCCCTCGCTGCCGTCGCCGACCATGCCCAACTTCAACATGGG 300


10046Ra-1.IR full       301 CGCCAACACGCCCAACGGACAGCCCGGCGGNNNNNCNGCCGCTGCTGCTGCGGCGNNTGC 360
                            ||||||||||||||||||||||||||||||     | ||||||||||||||||||  |||
10046Ra-1.in silico     301 CGCCAACACGCCCAACGGACAGCCCGGCGGAGCGGCCGCCGCTGCTGCTGCGGCGGCTGC 360


10046Ra-1.IR full       361 CGCGGACGGCGTCTTTCACGAACGGCATTCCACAAACGGCATTCCCAGGACATCCGCTGC 420
                            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
10046Ra-1.in silico     361 CGCGGACGGCGTCTT-CACGAACGGCATTCCACAAACGGCATTCCCAGGACATCCGCTGC 420


10046Ra-1.IR full       421 ACTTGACTATACCGCCACAAGGTTTGCCAAACGG-GATGCTGCTACCCTGCAACATGCCT 480
                            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
10046Ra-1.in silico     421 ACTTGACTATACCGCCACAAGGTTTGCCAAACGGCGATGCTGCTACCCTGCAACATGCCT 480


10046Ra-1.IR full       481 TCCCTGGTCTGCCACCGTTTC 501
                            |||||||||||||||||||||
10046Ra-1.in silico     481 TCCCTGGTCTGCCACCGTTTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.