National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10045R-6 
 Symbol GstD1  Full Name Glutathione S transferase D1 
 CG No CG10045  Old CG No CG10045 
 Synonyms GST-1, GSTD1, DmGSTD1-1, CG10045, T5, DmGSTD1, gstD1, DmGST1, DmGST-1, Gst, GST1, gst-D1-1, GST, G-S-T, Gst1-1, GST1-1, unnamed, GSt1-1, Gst1, DmGst1, GSTase, Gst1.1, GstD1 
 Accession No (Link to NCBI) NM_079602.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTTCTACTACCTGCCCGGCT 
 Primer Seq. 3'
aatctagaggtaccACCTCGAATGTGGACACGGTT 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ACTTCTACTA CCTGCCCGGC TCCTCCCCCT GCCGCTCCGT GATCATGACC GCCAAGGCCG 
0061 TGGGCGTCGA GCTGAACAAG AAGCTGCTCA ACCTGCAGGC CGGTGAGCAC CCTGAAGCCG 
0121 GAGTTCCTGA AGATCAATCC CCAGCACACC ATTCCCACGC TGGTGGACAA CGGATTCGCG 
0181 CTGTGGGAGT CCCGCGCCAT CCAGGTGTAT TTGGTGGAGA AGTACGGCAA GACCGACTCC 
0241 CTGTACCCTA AGTGCCCCAA GAAGCGCGCC GTGATCAATC AGCGCCTGTA CTTCGACATG 
0301 GGAACGCTGT ACCAGAGCTT CGCCAACTAC TACTACCCAC AGGTGTTCGC CAAGGCGCCC 
0361 GCCGATCCAG AGGCCTTCAA GAAGATCGAG GCCGCCTTCG AGTTCCTGAA CACCTTCCTG 
0421 GAGGGACAGG ACTACGCCGC CGGTGACTCC CTTACCGTAG CCGACANTTG CCCTGGTGGC 
0481 AACCGTGTCC ACATTCGAGG T 
 in silico PCR Fragment
0001 ACTTCTACTA CCTGCCCGGC TCCTCCCCCT GCCGCTCCGT GATCATGACC GCCAAGGCCG 
0061 TGGGCGTCGA GCTGAACAAG AAGCTGCTCA ACCTGCAGGC CGGTGAGCA- CCTGAAGCCG 
0121 GAGTTCCTGA AGATCAATCC CCAGCACACC ATTCCCACGC TGGTGGACAA CGGATTCGCG 
0181 CTGTGGGAGT CCCGCGCCAT CCAGGTGTAT TTGGTGGAGA AGTACGGCAA GACCGACTCC 
0241 CTGTACCCTA AGTGCCCCAA GAAGCGCGCC GTGATCAATC AGCGCCTGTA CTTCGACATG 
0301 GGAACGCTGT ACCAGAGCTT CGCCAACTAC TACTACCCAC AGGTGTTCGC CAAGGCGCCC 
0361 GCCGATCCAG AGGCCTTCAA GAAGATCGAG GCCGCCTTCG AGTTCCTGAA CACCTTCCTG 
0421 GAGGGACAGG ACTACGCCGC CGGTGACTCC CTTACCGTAG CCGACA-TTG CCCTGGTGGC 
0481 AACCGTGTCC ACATTCGAGG T 
 Assemble Data

10045R-6.IR_full       1   ACTTCTACTACCTGCCCGGCTCCTCCCCCTGCCGCTCCGTGATCATGACCGCCAAGGCCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10045R-6.in silico     1   ACTTCTACTACCTGCCCGGCTCCTCCCCCTGCCGCTCCGTGATCATGACCGCCAAGGCCG 60


10045R-6.IR_full       61  TGGGCGTCGAGCTGAACAAGAAGCTGCTCAACCTGCAGGCCGGTGAGCACCCTGAAGCCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
10045R-6.in silico     61  TGGGCGTCGAGCTGAACAAGAAGCTGCTCAACCTGCAGGCCGGTGAGCA-CCTGAAGCCG 120


10045R-6.IR_full       121 GAGTTCCTGAAGATCAATCCCCAGCACACCATTCCCACGCTGGTGGACAACGGATTCGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10045R-6.in silico     121 GAGTTCCTGAAGATCAATCCCCAGCACACCATTCCCACGCTGGTGGACAACGGATTCGCG 180


10045R-6.IR_full       181 CTGTGGGAGTCCCGCGCCATCCAGGTGTATTTGGTGGAGAAGTACGGCAAGACCGACTCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10045R-6.in silico     181 CTGTGGGAGTCCCGCGCCATCCAGGTGTATTTGGTGGAGAAGTACGGCAAGACCGACTCC 240


10045R-6.IR_full       241 CTGTACCCTAAGTGCCCCAAGAAGCGCGCCGTGATCAATCAGCGCCTGTACTTCGACATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10045R-6.in silico     241 CTGTACCCTAAGTGCCCCAAGAAGCGCGCCGTGATCAATCAGCGCCTGTACTTCGACATG 300


10045R-6.IR_full       301 GGAACGCTGTACCAGAGCTTCGCCAACTACTACTACCCACAGGTGTTCGCCAAGGCGCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10045R-6.in silico     301 GGAACGCTGTACCAGAGCTTCGCCAACTACTACTACCCACAGGTGTTCGCCAAGGCGCCC 360


10045R-6.IR_full       361 GCCGATCCAGAGGCCTTCAAGAAGATCGAGGCCGCCTTCGAGTTCCTGAACACCTTCCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10045R-6.in silico     361 GCCGATCCAGAGGCCTTCAAGAAGATCGAGGCCGCCTTCGAGTTCCTGAACACCTTCCTG 420


10045R-6.IR_full       421 GAGGGACAGGACTACGCCGCCGGTGACTCCCTTACCGTAGCCGACANTTGCCCTGGTGGC 480
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
10045R-6.in silico     421 GAGGGACAGGACTACGCCGCCGGTGACTCCCTTACCGTAGCCGACA-TTGCCCTGGTGGC 480


10045R-6.IR_full       481 AACCGTGTCCACATTCGAGGT 501
                           |||||||||||||||||||||
10045R-6.in silico     481 AACCGTGTCCACATTCGAGGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_001038953.1  CG10045-RB, transcript variant B (GstD1), mRNA 
100   481  NM_079602.3  CG10045-RA, transcript variant A (GstD1), mRNA 
4.57   22  40  50  50  NM_080173.1  CG4181-RA (GstD2), mRNA 
3.95   19  22  40  78  NM_080175.2  CG12242-RA (GstD5), mRNA 
3.95   19  16  37  48  NM_080174.2  CG11512-RA (GstD4), mRNA 
3.11   15  15  34  65  NM_144456.1  CG18548-RA (GstD10), mRNA 
2.49   12  26  19  40  NM_080375.1  CG4371-RA (GstD7), mRNA 
0.83   28  50  NM_141924.1  CG10091-RA (GstD9), mRNA 
0   14  39  90  NM_080177.1  CG4421-RA (GstD8), mRNA 
0   12  18  NM_137481.2  CG17524-RA (GstE3), mRNA 
0   43  45  NM_176479.1  CG4381-RA (GstD3), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   14  NM_166279.2  CG17534-RA (GstE9), mRNA 
0   NM_057629.3  CG4379-RA, transcript variant A (Pka-C1), mRNA 
0   NM_164866.1  CG4379-RB, transcript variant B (Pka-C1), mRNA 
0   NM_205950.1  CG4379-RC, transcript variant C (Pka-C1), mRNA 
0   NM_141142.1  CG6914-RA (CG6914), mRNA 
0   NM_143323.3  CG12880-RA (CG12880), mRNA 
0   NM_143666.2  CG2009-RA (bip2), mRNA 
0   NM_134701.2  CG3883-RA (CG3883), mRNA 
0   NM_137061.2  CG6337-RA (CG6337), mRNA 
0   NM_141886.2  CG3571-RA, transcript variant A (CG3571), mRNA 
0   NM_169446.1  CG3571-RB, transcript variant B (CG3571), mRNA 
0   NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
0   NM_079935.2  CG8094-RA (Hex-C), mRNA 
0   NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0   NM_167396.1  CG32604-RB, transcript variant B (l(1)G0007), mRNA 
0   NM_079113.2  CG4012-RA (gek), mRNA 
0   NM_133075.2  CG6461-RA (CG6461), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.