National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10043R-3 
 Symbol rtGEF  Full Name rho-type guanine exchange factor 
 CG No CG10043  Old CG No CG10043 
 Synonyms dpix, rhoGEF, 38C.40, DrhoGEF, DrtGEF, RhoGEF, Rho/RacGEF, CG10043, rtGEF, rho-type guanine exchange factor, Drosophila rho-type guanine exchange factor 
 Accession No (Link to NCBI) NM_001103714 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCTTCGCTAGGACACCTAA 
 Primer Seq. 3'
aatctagaggtaccGGAATCGTTCCGCTTGTTTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCTTCGCT AGGACACCTA AATGCCGCTC ATCCTGAGTC AACATTTGGA TTCACGGGGC 
0061 TACTGCACGC GATTCTCGCT GTGTGCCTAT TACTCCAGCC CCCCGTGCCA TGTGCGACCT 
0121 CTCCGTGTGA CTCTTCCCCC AAGCAATTAC CCAGCAACAG CTCCGTACGC CAATCTTAGT 
0181 GCTCACTTTG CCAGGCTTGT TAAAGGCGGC GGACTGAGGA GTGCTATCGT AAAGATGCTT 
0241 CTGTATCCGC AGGCTCGCCA GAGCATCGAA TCTCAAAAGG ATTGCGTTGC GCAAAAGGCG 
0301 TTGTCACAAG GCATCTGCAA AGTTAAAAGA TCTCAATACC AATCAGGATT CGGGGCAGTC 
0361 CGAGTTGGAA CGACAGGATG CAATTGAACT ACCAACGGAC TCGGAGAGCT ATGACGATGA 
0421 CTTTGAAGAT GATTTTTTGC ATTCCTGCGA CTCGGATCCG TTTGAATATG TGCAGTGTTT 
0481 TACCAAAACA AGCGGAACGA TTCC 
 in silico PCR Fragment
0001 ACTCTTCGCT AGGACACCTA AATGCCGCTC AT-CTGAGTC AACATTTGGA TTCACGGGGC 
0061 TACTGCACGC GATTCTCGCT GTGTGCCTAT TACTCCAGCC CCCCGTGCCA TGTGCGACCT 
0121 CTCCGTGTGA CTCTTCCCCC AAGCAATTAC CCAGCAACAG CTCCGTACGC CAATCTTAGT 
0181 GCTCACTTTG CCAGGCTTGT TAAAGGCGGC GGACTGAGGA GTGCTATCGT AAAGATGCTT 
0241 CTGTATCCGC AGGCTCGCCA GAGCATCG-A TCTCAAAAGG ATTGCGTTGC GCAAAAGGCG 
0301 TTGTCACAAG GCATCTGCAA AGTTAAAAGA TCTCAATACC AATCAGGATT CGGGGCAGTC 
0361 CGAGTTGGAA CGACAGGATG CAATTGAACT ACCAACGGAC TCGGAGAGCT ATGACGATGA 
0421 CTTTGAAGAT GATTTTTTGC ATTCCTGCGA CTCGGATCCG TTTGAATATG TGCA--GTTT 
0481 TACCAAAACA AGCGGAACGA TTCC 
 Assemble Data

10043R-3.IR_full       1   ACTCTTCGCTAGGACACCTAAATGCCGCTCATCCTGAGTCAACATTTGGATTCACGGGGC 60
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
10043R-3.in silico     1   ACTCTTCGCTAGGACACCTAAATGCCGCTCAT-CTGAGTCAACATTTGGATTCACGGGGC 60


10043R-3.IR_full       61  TACTGCACGCGATTCTCGCTGTGTGCCTATTACTCCAGCCCCCCGTGCCATGTGCGACCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10043R-3.in silico     61  TACTGCACGCGATTCTCGCTGTGTGCCTATTACTCCAGCCCCCCGTGCCATGTGCGACCT 120


10043R-3.IR_full       121 CTCCGTGTGACTCTTCCCCCAAGCAATTACCCAGCAACAGCTCCGTACGCCAATCTTAGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10043R-3.in silico     121 CTCCGTGTGACTCTTCCCCCAAGCAATTACCCAGCAACAGCTCCGTACGCCAATCTTAGT 180


10043R-3.IR_full       181 GCTCACTTTGCCAGGCTTGTTAAAGGCGGCGGACTGAGGAGTGCTATCGTAAAGATGCTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10043R-3.in silico     181 GCTCACTTTGCCAGGCTTGTTAAAGGCGGCGGACTGAGGAGTGCTATCGTAAAGATGCTT 240


10043R-3.IR_full       241 CTGTATCCGCAGGCTCGCCAGAGCATCGAATCTCAAAAGGATTGCGTTGCGCAAAAGGCG 300
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
10043R-3.in silico     241 CTGTATCCGCAGGCTCGCCAGAGCATCG-ATCTCAAAAGGATTGCGTTGCGCAAAAGGCG 300


10043R-3.IR_full       301 TTGTCACAAGGCATCTGCAAAGTTAAAAGATCTCAATACCAATCAGGATTCGGGGCAGTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10043R-3.in silico     301 TTGTCACAAGGCATCTGCAAAGTTAAAAGATCTCAATACCAATCAGGATTCGGGGCAGTC 360


10043R-3.IR_full       361 CGAGTTGGAACGACAGGATGCAATTGAACTACCAACGGACTCGGAGAGCTATGACGATGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10043R-3.in silico     361 CGAGTTGGAACGACAGGATGCAATTGAACTACCAACGGACTCGGAGAGCTATGACGATGA 420


10043R-3.IR_full       421 CTTTGAAGATGATTTTTTGCATTCCTGCGACTCGGATCCGTTTGAATATGTGCAGTGTTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||
10043R-3.in silico     421 CTTTGAAGATGATTTTTTGCATTCCTGCGACTCGGATCCGTTTGAATATGTGCA--GTTT 480


10043R-3.IR_full       481 TACCAAAACAAGCGGAACGATTCC 504
                           ||||||||||||||||||||||||
10043R-3.in silico     481 TACCAAAACAAGCGGAACGATTCC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.