National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10042R-3 
 Symbol MBD-R2  Full Name MBD-R2 
 CG No CG10042  Old CG No CG10042 
 Synonyms dMBD-R2, TAM3, Dm Tam3, CG10042, MBD, CG17393, MBD-R2 
 Accession No (Link to NCBI) NM_141921.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCGTGGAGGGAACGACTGA 
 Primer Seq. 3'
aatctagaggtaccTGGCCATCCACTCCTGAAAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCGTGGAG GGAACGACTG AAACCCCGGG AAATGCTCAG TCATCGACCA ATGACGATGT 
0061 GATCAAAGCT ACGGTAGACC AAATAGTTGC GCAAATCCTG TCGGAATCTG CAGAACGCAA 
0121 GGCCACGGAG GAAGGTAAAA CAGGCAAGGC GGCGGATGAC GTTAAAAATA CTCCCGAAAG 
0181 TGGAGAAGAT GCAAACAAGG CAGCTGCAAA GGAACCCTCA GGGACTCCGG TAGCCGCAAG 
0241 CAGCGAAGCC ACAGTCCCAG CTCCTGGATC CGCTTTCCAG TTCGAACTCA CCTTTGCCCG 
0301 GCACACCGCC CAAGTACAGC AACCCACATA ACCTGACTAT TGGCGCCCGT TTGGAGGCGC 
0361 TCAGTGTGGA AGGCAACTGG TTGCCCGCCC GCATCGTGGA AGTTAACGAG ACGGAGCAGA 
0421 CGCTACTCNT GCGCTTTGAG CGCAATCACA AGCTAAAGGT GTCACCTTCG ACCAGCGGCA 
0481 GCTTTCAGGA GTGGATGGCC A 
 in silico PCR Fragment
0001 CAGCGTGGAG GGAACGACTG AAACCCCGGG AAATGCTCAG TCATCGACCA ATGACGATGT 
0061 GATCAAAGCT ACGGTAGACC AAATAGTTGC GCAAATCCTG TCGGAATCTG CAGAACGCAA 
0121 GGCCACGGAG GAAGGTAAAA CAGGCAAGGC GGCGGATGAC GTTAAAAATA CTCCCGAAAG 
0181 TGGAGAAGAT GCAAACAAGG CAGCTGCAAA GGAACCCTCA GGGACTCCGG TAGCCGCAAG 
0241 CAGCGAAGCC ACAGTCCCAG CTCCTGGATC CGC-TTCCAG TTCGAACTCA CCTTTGCCCG 
0301 GCACACCGCC CAAGTACAGC AACCCACATA ACCTGACTAT TGGCGCCCGT TTGGAGGCGC 
0361 TCAGTGTGGA AGGCAACTGG TTGCCCGCCC GCATCGTGGA AGTTAACGAG ACGGAGCAGA 
0421 CGCTACTCGT GCGCTTTGAG CGCAATCACA AGCTAAAGGT GTCACCTTCG ACCAGCGGCA 
0481 GCTTTCAGGA GTGGATGGCC A 
 Assemble Data

10042R-3.IR_full       1   CAGCGTGGAGGGAACGACTGAAACCCCGGGAAATGCTCAGTCATCGACCAATGACGATGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     1   CAGCGTGGAGGGAACGACTGAAACCCCGGGAAATGCTCAGTCATCGACCAATGACGATGT 60


10042R-3.IR_full       61  GATCAAAGCTACGGTAGACCAAATAGTTGCGCAAATCCTGTCGGAATCTGCAGAACGCAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     61  GATCAAAGCTACGGTAGACCAAATAGTTGCGCAAATCCTGTCGGAATCTGCAGAACGCAA 120


10042R-3.IR_full       121 GGCCACGGAGGAAGGTAAAACAGGCAAGGCGGCGGATGACGTTAAAAATACTCCCGAAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     121 GGCCACGGAGGAAGGTAAAACAGGCAAGGCGGCGGATGACGTTAAAAATACTCCCGAAAG 180


10042R-3.IR_full       181 TGGAGAAGATGCAAACAAGGCAGCTGCAAAGGAACCCTCAGGGACTCCGGTAGCCGCAAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     181 TGGAGAAGATGCAAACAAGGCAGCTGCAAAGGAACCCTCAGGGACTCCGGTAGCCGCAAG 240


10042R-3.IR_full       241 CAGCGAAGCCACAGTCCCAGCTCCTGGATCCGCTTTCCAGTTCGAACTCACCTTTGCCCG 300
                           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
10042R-3.in silico     241 CAGCGAAGCCACAGTCCCAGCTCCTGGATCCGC-TTCCAGTTCGAACTCACCTTTGCCCG 300


10042R-3.IR_full       301 GCACACCGCCCAAGTACAGCAACCCACATAACCTGACTATTGGCGCCCGTTTGGAGGCGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     301 GCACACCGCCCAAGTACAGCAACCCACATAACCTGACTATTGGCGCCCGTTTGGAGGCGC 360


10042R-3.IR_full       361 TCAGTGTGGAAGGCAACTGGTTGCCCGCCCGCATCGTGGAAGTTAACGAGACGGAGCAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     361 TCAGTGTGGAAGGCAACTGGTTGCCCGCCCGCATCGTGGAAGTTAACGAGACGGAGCAGA 420


10042R-3.IR_full       421 CGCTACTCNTGCGCTTTGAGCGCAATCACAAGCTAAAGGTGTCACCTTCGACCAGCGGCA 480
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
10042R-3.in silico     421 CGCTACTCGTGCGCTTTGAGCGCAATCACAAGCTAAAGGTGTCACCTTCGACCAGCGGCA 480


10042R-3.IR_full       481 GCTTTCAGGAGTGGATGGCCA 501
                           |||||||||||||||||||||
10042R-3.in silico     481 GCTTTCAGGAGTGGATGGCCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169461.1  CG10042-RB, transcript variant B (MBD-R2), mRNA 
100   482  NM_141921.1  CG10042-RA, transcript variant A (MBD-R2), mRNA 
0   NM_135493.2  CG13131-RA (CG13131), mRNA 
0   12  NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_206516.1  CG14307-RI, transcript variant I (fru), mRNA 
0   NM_169819.1  CG14307-RE, transcript variant E (fru), mRNA 
0   NM_169820.1  CG14307-RC, transcript variant C (fru), mRNA 
0   NM_206515.1  CG14307-RJ, transcript variant J (fru), mRNA 
0   NM_206513.1  CG14307-RL, transcript variant L (fru), mRNA 
0   NM_206512.1  CG14307-RM, transcript variant M (fru), mRNA 
0   NM_167466.1  CG9012-RB, transcript variant B (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_139753.1  CG10477-RA (CG10477), mRNA 
0   NM_057797.2  CG10387-RA (tos), mRNA 
0   NM_140957.2  CG5528-RA (Toll-9), mRNA 
0   NM_001043294.1  CG34130-RA (CG34130), mRNA 
0   NM_139456.2  CG8985-RA (DmsR-1), mRNA 
0   NM_079439.2  CG9383-RA (asf1), mRNA 
0   NM_058151.4  CG6551-RA (fu), mRNA 
0   NM_079378.2  CG5444-RA, transcript variant A (Taf4), mRNA 
0   NM_176333.1  CG5444-RC, transcript variant C (Taf4), mRNA 
0   NM_206379.1  CG5444-RD, transcript variant D (Taf4), mRNA 
0   NM_168651.1  CG5444-RB, transcript variant B (Taf4), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   13  NM_206761.1  CG33251-RA (CG33251), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.