National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10041R-3 
 Symbol CG10041  Full Name CG10041 
 CG No CG10041  Old CG No CG10041 
 Synonyms SP178, CG10041 
 Accession No (Link to NCBI) NM_141920.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTGTCGACCACGAAGGTGATAAGTTTCCGCCCTCGTTATCCATACATCGTCTCCATAGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGAACCTTAAAGGATACTACAAGCACCTTTGCGTGGGCGTTATACTTTCGAATGAGTTC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTGCTCAGTGCAGCCCACTGCATCCAAACGAATCCAACCAAACAACTGTACGTGGCTGGT 180

                           |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCGCCGATTCGCTGAACAGCCGGAAGCAGACCCGCTTCTTCGTCGTGGAAAGAAGATGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATCCCCAGTTTAGGGTGCTCGGCGGCAACGACATTGCCGTGTTGAGGATTTACCCCAAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     301 TTCCCGCTCGACGATGTGCGATTTCGTAGCATTAACTTTGCTGGAAAGCCTCAAAGGGAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGTGGCACCCAGGCCTCGCTGGTTGGCTGGGGTCGGGTTGGCGTCGGCAAGATAAGAAAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTCCAGGAGATGCCCTTCTTGACCATGGAGAACGATGAGTGCCAGCAAAGCCATCGCTTC 480

10041R-3.IR_full       481 GTTTTCCTCAAACCGCTTGA 500
                           |||||||||||||||||||| silico     481 GTTTTCCTCAAACCGCTTGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141920.1  CG10041-RA (CG10041), mRNA 
0   NM_142437.2  CG7993-RA (CG7993), mRNA 
0   NM_132888.1  CG13957-RA (CG13957), mRNA 
0   NM_139661.2  CG7471-RA (Rpd3), mRNA 
0   NM_058151.4  CG6551-RA (fu), mRNA 
0   NM_165975.1  CG4712-RA, transcript variant A (CG4712), mRNA 
0   NM_132912.1  CG4521-RA (mthl1), mRNA 
0   NM_137012.1  CG4712-RB, transcript variant B (CG4712), mRNA 
0   NM_170199.1  CG11836-RB, transcript variant B (CG11836), mRNA 
0   NM_143076.2  CG11836-RA, transcript variant A (CG11836), mRNA 
0   NM_166542.1  CG30273-RA (CG30273), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_079469.2  CG10573-RA (ko), mRNA 
0   NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_130658.2  CG10260-RB (CG10260), mRNA 
0   NM_131960.1  CG6978-RA (CG6978), mRNA 
0   NM_143725.2  CG18039-RA (KaiRIA), mRNA 
0   NM_176739.1  CG33173-RA (CG33173), mRNA 
0   NM_164469.1  CG17239-RA (CG17239), mRNA 
0   NM_143083.2  CG10238-RA (CG10238), mRNA 
0   NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
0   NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
0   NM_143340.2  CG5508-RA, transcript variant A (CG5508), mRNA 
0   NM_078873.2  CG15162-RA (MESR3), mRNA 
0   NM_058072.3  CG8432-RA (Rep), mRNA 
0   NM_136595.1  CG13744-RA (CG13744), mRNA 
0   12  NM_168809.1  CG8756-RA, transcript variant A (LCBP1), mRNA 
0   12  NM_168808.1  CG8756-RC, transcript variant C (LCBP1), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.