National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10036R-1 
 Symbol otp  Full Name orthopedia 
 CG No CG10036  Old CG No CG10036 
 Synonyms Otp, w26, bk24, W26, CG2965, CG10036, BcDNA:RE58095, otp, orthopedia, Orthopedia 
 Accession No (Link to NCBI) NM_079075.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTATCCGGACATCTTCATGC 
 Primer Seq. 3'
aatctagaggtaccTTGGTGAGTTTGCTGTTGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTATCCGGA CATCTTCATG CGCGAGGAGA TCGCCATGCG GATTGGCCTC ACTGAGTCCC 
0061 GCGTTCAGGT CTGGTTCCAG AACCGCCGTG CCAAGTGGAA GAAGCGCAAG AAGACAACCA 
0121 ATGTCTTCCG CACCCCGGGC GCCCTGCTGC CCTCCCATGG ACTTCCGCCG TTTGGAGCGA 
0181 ATATAACTAA TATCGCCATG GGCGATGGTC TCTGTGGCAC AGGAATGTTT GGCGGAGATC 
0241 GCTGGAGCGT GGGTGTCAAT CCAATGACGG CAGGCGACTC CATGATGTAC CAGCACAGTG 
0301 TGGGCGGAGT CAGTTGTGGG CCCAGTGGTT CGCCGAGCGC CACCACCCCG CCGAACATGA 
0361 ACAGCTGCTC CTCGGTGACC CCGCCGCCAC TTTCCGCGCA GCCGAACTCC AGCCAGAACG 
0421 AGCTGAACGG CGAGCCCATG CCGCTGCATC AGCAGCAACA ACAACAGACT CACCAACATC 
0481 AGCAACAGCA AACTCACCAA  
 in silico PCR Fragment
0001 ACTATCCGGA CATCTTCATG CGCGAGGAGA TCGCCATGCG GATTGGCCTC ACTGAGTCCC 
0061 GCGTTCAGGT CTGGTTCCAG AACCGCCGTG CCAAGTGGAA GAAGCGCAAG AAGACAACCA 
0121 ATGTCTTCCG CACCCCGGGC GCCCTGCTGC CCTCCCATGG ACTTCCGCCG TTTGGGGCCA 
0181 ATATAACCAA TATCGCCATG GGCGATGGTC TCTGTGGCAC GGGAATGTTT GGCGGAGATC 
0241 GCTGGAGCGT GGGTGTCAAT CCAATGACGG CAGGCGACTC CATGATGTAC CAGCACAGTG 
0301 TGGGCGGAGT CAGTTGTGGG CCCAGTGGTT CGCCGAGCGC CACCACCCCG CCGAACATGA 
0361 ACAGCTGCTC CTCGGTGACC CCGCCGCCAC TTTCCGCGCA GCCGAACTCC AGCCAAAACG 
0421 AGCTGAACGG CGAGCCCATG CCGCTGCACC AGCAGCAACA ACAACAGACT CACCAACATC 
0481 AGCAACAGCA AACTCACCAA  
 Assemble Data

10036R-1.IR_full       1   ACTATCCGGACATCTTCATGCGCGAGGAGATCGCCATGCGGATTGGCCTCACTGAGTCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10036R-1.in silico     1   ACTATCCGGACATCTTCATGCGCGAGGAGATCGCCATGCGGATTGGCCTCACTGAGTCCC 60


10036R-1.IR_full       61  GCGTTCAGGTCTGGTTCCAGAACCGCCGTGCCAAGTGGAAGAAGCGCAAGAAGACAACCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10036R-1.in silico     61  GCGTTCAGGTCTGGTTCCAGAACCGCCGTGCCAAGTGGAAGAAGCGCAAGAAGACAACCA 120


10036R-1.IR_full       121 ATGTCTTCCGCACCCCGGGCGCCCTGCTGCCCTCCCATGGACTTCCGCCGTTTGGAGCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
10036R-1.in silico     121 ATGTCTTCCGCACCCCGGGCGCCCTGCTGCCCTCCCATGGACTTCCGCCGTTTGGGGCCA 180


10036R-1.IR_full       181 ATATAACTAATATCGCCATGGGCGATGGTCTCTGTGGCACAGGAATGTTTGGCGGAGATC 240
                           ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||
10036R-1.in silico     181 ATATAACCAATATCGCCATGGGCGATGGTCTCTGTGGCACGGGAATGTTTGGCGGAGATC 240


10036R-1.IR_full       241 GCTGGAGCGTGGGTGTCAATCCAATGACGGCAGGCGACTCCATGATGTACCAGCACAGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10036R-1.in silico     241 GCTGGAGCGTGGGTGTCAATCCAATGACGGCAGGCGACTCCATGATGTACCAGCACAGTG 300


10036R-1.IR_full       301 TGGGCGGAGTCAGTTGTGGGCCCAGTGGTTCGCCGAGCGCCACCACCCCGCCGAACATGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10036R-1.in silico     301 TGGGCGGAGTCAGTTGTGGGCCCAGTGGTTCGCCGAGCGCCACCACCCCGCCGAACATGA 360


10036R-1.IR_full       361 ACAGCTGCTCCTCGGTGACCCCGCCGCCACTTTCCGCGCAGCCGAACTCCAGCCAGAACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
10036R-1.in silico     361 ACAGCTGCTCCTCGGTGACCCCGCCGCCACTTTCCGCGCAGCCGAACTCCAGCCAAAACG 420


10036R-1.IR_full       421 AGCTGAACGGCGAGCCCATGCCGCTGCATCAGCAGCAACAACAACAGACTCACCAACATC 480
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
10036R-1.in silico     421 AGCTGAACGGCGAGCCCATGCCGCTGCACCAGCAGCAACAACAACAGACTCACCAACATC 480


10036R-1.IR_full       481 AGCAACAGCAAACTCACCAA 500
                           ||||||||||||||||||||
10036R-1.in silico     481 AGCAACAGCAAACTCACCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_206187.2  CG10036-RB, transcript variant B (otp), mRNA 
100   482  16  NM_001043098.1  CG10036-RC, transcript variant C (otp), mRNA 
100   482  16  NM_079075.4  CG10036-RA, transcript variant A (otp), mRNA 
0.82   11  NM_133014.2  CG6269-RA (unc-4), mRNA 
0.62   NM_079110.2  CG11182-RA (PHDP), mRNA 
0.62   11  NM_164547.1  CG2808-RB, transcript variant B (CG2808), mRNA 
0.62   42  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0.62   42  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0.41   29  116  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0.41   15  NM_140568.1  CG5830-RA (CG5830), mRNA 
0.41   18  86  NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0.41   18  86  NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0.41   18  83  NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 
0.41   38  NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0.41   27  NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0.41   27  NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0.41   27  NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0.41   27  NM_206249.2  CG16973-RE, transcript variant E (msn), mRNA 
0.2   10  18  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
0.2   10  18  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
0.2   16  43  NM_140800.2  CG6884-RA (MED11), mRNA 
0.2   22  NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0.2   21  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0.2   27  90  NM_057489.3  CG4722-RA (bib), mRNA 
0.2   14  NM_169293.1  CG8208-RA, transcript variant A (MBD-like), mRNA 
0.2   12  NM_141650.2  CG8208-RB, transcript variant B (MBD-like), mRNA 
0.2   11  NM_164743.1  CG31906-RA (CG31906), mRNA 
0.2   11  31  NM_057265.3  CG1264-RA (lab), mRNA 
0   22  107  358  NM_168571.2  CG32133-RA (CG32133), mRNA 
0   22  83  256  NM_135077.2  CG14023-RA (CG14023), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
-+ 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.