National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10036R-1 
 Symbol otp  Full Name orthopedia 
 CG No CG10036  Old CG No CG10036 
 Synonyms Otp, w26, bk24, W26, CG2965, CG10036, BcDNA:RE58095, otp, orthopedia, Orthopedia 
 Accession No (Link to NCBI) NM_079075.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTATCCGGACATCTTCATGCGCGAGGAGATCGCCATGCGGATTGGCCTCACTGAGTCCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGTTCAGGTCTGGTTCCAGAACCGCCGTGCCAAGTGGAAGAAGCGCAAGAAGACAACCA 120

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | silico     121 ATGTCTTCCGCACCCCGGGCGCCCTGCTGCCCTCCCATGGACTTCCGCCGTTTGGGGCCA 180

                           ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     181 ATATAACCAATATCGCCATGGGCGATGGTCTCTGTGGCACGGGAATGTTTGGCGGAGATC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCTGGAGCGTGGGTGTCAATCCAATGACGGCAGGCGACTCCATGATGTACCAGCACAGTG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGGCGGAGTCAGTTGTGGGCCCAGTGGTTCGCCGAGCGCCACCACCCCGCCGAACATGA 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     361 ACAGCTGCTCCTCGGTGACCCCGCCGCCACTTTCCGCGCAGCCGAACTCCAGCCAAAACG 420

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     421 AGCTGAACGGCGAGCCCATGCCGCTGCACCAGCAGCAACAACAACAGACTCACCAACATC 480

10036R-1.IR_full       481 AGCAACAGCAAACTCACCAA 500
                           |||||||||||||||||||| silico     481 AGCAACAGCAAACTCACCAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_206187.2  CG10036-RB, transcript variant B (otp), mRNA 
100   482  16  NM_001043098.1  CG10036-RC, transcript variant C (otp), mRNA 
100   482  16  NM_079075.4  CG10036-RA, transcript variant A (otp), mRNA 
0.82   11  NM_133014.2  CG6269-RA (unc-4), mRNA 
0.62   NM_079110.2  CG11182-RA (PHDP), mRNA 
0.62   11  NM_164547.1  CG2808-RB, transcript variant B (CG2808), mRNA 
0.62   42  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0.62   42  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0.41   29  116  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
0.41   15  NM_140568.1  CG5830-RA (CG5830), mRNA 
0.41   18  86  NM_001014681.1  CG33553-RD, transcript variant D (Doa), mRNA 
0.41   18  86  NM_001043298.1  CG33553-RH, transcript variant H (Doa), mRNA 
0.41   18  83  NM_001014679.1  CG33553-RC, transcript variant C (Doa), mRNA 
0.41   38  NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0.41   27  NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0.41   27  NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0.41   27  NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0.41   27  NM_206249.2  CG16973-RE, transcript variant E (msn), mRNA 
0.2   10  18  NM_057606.4  CG1759-RA, transcript variant A (cad), mRNA 
0.2   10  18  NM_134301.3  CG1759-RB, transcript variant B (cad), mRNA 
0.2   16  43  NM_140800.2  CG6884-RA (MED11), mRNA 
0.2   22  NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0.2   21  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0.2   27  90  NM_057489.3  CG4722-RA (bib), mRNA 
0.2   14  NM_169293.1  CG8208-RA, transcript variant A (MBD-like), mRNA 
0.2   12  NM_141650.2  CG8208-RB, transcript variant B (MBD-like), mRNA 
0.2   11  NM_164743.1  CG31906-RA (CG31906), mRNA 
0.2   11  31  NM_057265.3  CG1264-RA (lab), mRNA 
0   22  107  358  NM_168571.2  CG32133-RA (CG32133), mRNA 
0   22  83  256  NM_135077.2  CG14023-RA (CG14023), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.