National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10034R-1 
 Symbol tj  Full Name traffic jam 
 CG No CG10034  Old CG No CG10034 
 Synonyms maf-L, CG10034, Dmaf, PL3, maf1, fs(2)eoPL3, fs(2)eo2, fs(2)eo-B, tj 
 Accession No (Link to NCBI) NM_136125.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Panchal T, Chen X, Alchits E, Oh Y, Poon J, Kouptsova J, Laski FA, Godt D.
Specification and spatial arrangement of cells in the germline stem cell niche of the Drosophila ovary depend on the Maf transcription factor Traffic jam.
PLoS Genet. (2017) 13(5) e1006790 [ PubMed ID = 28542174 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGACACGTACGTTCAGGAGT 
 Primer Seq. 3'
aatctagaggtaccGTGGTGTGCGTAAGTCTGAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGACACGTA CGTTCAGGAG TTTGATCTGC ACCACCTGGA GGTGGGCGGA AATGGAGCTG 
0061 GCCAATCGCA TGGAGCCGGT GCCGCGTCCC AGGTCACGAC TTTGGGCCAT GTGAAGCGCG 
0121 AGGATCACAG TCCACCGCAG CCGGTGGCGG TTAAATGGAC GACAATCCAC GGCGATCCCA 
0181 CGAATCCGGA CGATGACCCG GACTCGCTGC CGCTGTCCGG ACCAGAGCCC GCCGGAGCAG 
0241 TGGAGGTCTC GCCATCGCCG CACATCAAGC TGAGGTCCTT CTCCGGCCAT CACCAGTGGC 
0301 ACATGGACGA NCGGCGCCTG CAACCGCTCT CTCCGCCACC AGAGCAGTAT GGTCCGCTGC 
0361 CCGGACAGGC GATTCTGGTG AACACATCTT CGGGAGCGGG CGTTCCGGGC GGAGTGCCCT 
0421 CAACGCCGCC GGAAACGCCA CCAGTAGTGG GCTCGCCcAC GGGCAGCAGC AGCTGTCCGG 
0481 CTCAGACTTA CGCACACCAC  
 in silico PCR Fragment
0001 ACGACACGTA CGTTCAGGAG TTTGATCTGC ACCACCTGGA GGTGGGCGGA AATGGAGCTG 
0061 GCCAATCGCA TGGAGCCGGT GCCGCGTCCC AGGTCACGAC TTTGGGCCAT GTGAAGCGCG 
0121 AGGATCACAG TCCACCGCAG CCGGTGGCGG TTAAATGGAC GACAATCCAC GGCGATCCCA 
0181 CGAATCCGGA CGATGACCCG GACTCGCTGC CGCTGTCCGG ACCAGAGCCC GCCGGAGCAG 
0241 TGGAGGTCTC GCCATCGCCG CACATCAAGC TGAGGTCCTT CTCCGGCCAT CACCAGTGGC 
0301 ACATGGACGA ACGGCGCCTG CAACCGCTCT CTCCGCCACC AGAGCAGTAT GGTCCGCTGC 
0361 CCGGACAGGC GATTCTGGTG AACACATCTT CGGGAGCGGG CGTTCCGGGC GGAGTGCCCT 
0421 CAACGCCGCC GGAAACGCCA CCAGTAGTGG GCTCGCCCAC GGGCAGCAGC AGCTGTCCGG 
0481 CTCAGACTTA CGCACACCAC  
 Assemble Data

10034R-1.IR_full       1   ACGACACGTACGTTCAGGAGTTTGATCTGCACCACCTGGAGGTGGGCGGAAATGGAGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     1   ACGACACGTACGTTCAGGAGTTTGATCTGCACCACCTGGAGGTGGGCGGAAATGGAGCTG 60


10034R-1.IR_full       61  GCCAATCGCATGGAGCCGGTGCCGCGTCCCAGGTCACGACTTTGGGCCATGTGAAGCGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     61  GCCAATCGCATGGAGCCGGTGCCGCGTCCCAGGTCACGACTTTGGGCCATGTGAAGCGCG 120


10034R-1.IR_full       121 AGGATCACAGTCCACCGCAGCCGGTGGCGGTTAAATGGACGACAATCCACGGCGATCCCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     121 AGGATCACAGTCCACCGCAGCCGGTGGCGGTTAAATGGACGACAATCCACGGCGATCCCA 180


10034R-1.IR_full       181 CGAATCCGGACGATGACCCGGACTCGCTGCCGCTGTCCGGACCAGAGCCCGCCGGAGCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     181 CGAATCCGGACGATGACCCGGACTCGCTGCCGCTGTCCGGACCAGAGCCCGCCGGAGCAG 240


10034R-1.IR_full       241 TGGAGGTCTCGCCATCGCCGCACATCAAGCTGAGGTCCTTCTCCGGCCATCACCAGTGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     241 TGGAGGTCTCGCCATCGCCGCACATCAAGCTGAGGTCCTTCTCCGGCCATCACCAGTGGC 300


10034R-1.IR_full       301 ACATGGACGANCGGCGCCTGCAACCGCTCTCTCCGCCACCAGAGCAGTATGGTCCGCTGC 360
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     301 ACATGGACGAACGGCGCCTGCAACCGCTCTCTCCGCCACCAGAGCAGTATGGTCCGCTGC 360


10034R-1.IR_full       361 CCGGACAGGCGATTCTGGTGAACACATCTTCGGGAGCGGGCGTTCCGGGCGGAGTGCCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     361 CCGGACAGGCGATTCTGGTGAACACATCTTCGGGAGCGGGCGTTCCGGGCGGAGTGCCCT 420


10034R-1.IR_full       421 CAACGCCGCCGGAAACGCCACCAGTAGTGGGCTCGCCCACGGGCAGCAGCAGCTGTCCGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10034R-1.in silico     421 CAACGCCGCCGGAAACGCCACCAGTAGTGGGCTCGCCCACGGGCAGCAGCAGCTGTCCGG 480


10034R-1.IR_full       481 CTCAGACTTACGCACACCAC 500
                           ||||||||||||||||||||
10034R-1.in silico     481 CTCAGACTTACGCACACCAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136125.1  CG10034-RA (tj), mRNA 
0   NM_142346.1  CG5246-RA (CG5246), mRNA 
0   NM_138265.2  CG13916-RA (SA-2), mRNA 
0   10  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   10  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_132384.2  CG2962-RA (CG2962), mRNA 
0   NM_164830.3  CG18405-RA, transcript variant A (Sema-1a), mRNA 
0   NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 
0   NM_130492.2  CG13366-RA, transcript variant A (CG13366), mRNA 
0   NM_057719.3  CG8274-RA (Mtor), mRNA 
0   NM_137663.1  CG13437-RA (CG13437), mRNA 
0   NM_135057.1  CG9121-RA (CG9121), mRNA 
0   NM_136367.1  CG30431-RA (CG30431), mRNA 
0   NM_167985.1  CG14955-RB, transcript variant B (CG14955), mRNA 
0   NM_139512.1  CG14955-RA, transcript variant A (CG14955), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_168473.2  CG32088-RA (CG32088), mRNA 
0   NM_167436.1  CG6170-RB, transcript variant B (HDAC6), mRNA 
0   NM_167437.1  CG6170-RC, transcript variant C (HDAC6), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_057999.4  CG4602-RA (Srp54), mRNA 
0   NM_170105.1  CG31451-RA (CG31451), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_166327.1  CG15118-RD, transcript variant D (CG15118), mRNA 
0   NM_137552.2  CG15118-RB, transcript variant B (CG15118), mRNA 
0   NM_166325.1  CG15118-RA, transcript variant A (CG15118), mRNA 
0   NM_166326.1  CG15118-RC, transcript variant C (CG15118), mRNA 
0   NM_168019.2  CG32279-RA (dro2), mRNA 
0   13  NM_143645.1  CG1976-RA (RhoGAP100F), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.