National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10026R-2 
 Symbol CG10026  Full Name CG10026 
 CG No CG10026  Old CG No CG10026 
 Synonyms CG10026 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACAAGCTAAACATCACCGAG 
 Primer Seq. 3'
aatctagaggtaccCCCAGGTCCTTCAGATCGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10026R-2.IR full       1   CACAAGCTAAACATCACCGAGGAGGAGGTTCCGGAGCANNTCCNNCGACTTGCCCAGGAG 60
                           ||||||||||||||||||||||||||||||||||||||  |||  |||||||||||||||
10026R-2.in silico     1   CACAAGCTAAACATCACCGAGGAGGAGGTTCCGGAGCACATCCGCCGACTTGCCCAGGAG 60


10026R-2.IR full        61  AGNGNGAGTGTCCCAGTTCCAAGGATAAGGTCATCGAACAATTCCGTAACTACATACTA 119
                            || | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico      61  AGGGAGAGTGTCCCAGTTCCAAGGATAAGGTCATCGAACAATTCCGTAACTACATACTA 119


10026R-2.IR full       121 GAACATAATGAATGCCAACCACACAGAAGTGATGCGAAGTACCTGGAGAAATTCCTAAGA 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico     121 GAACATAATGAATGCCAACCACACAGAAGTGATGCGAAGTACCTGGAGAAATTCCTAAGA 179


10026R-2.IR full       181 GCCCGCTACTGGAAAATCGAGAACAGTTACAAATTGCTCTGCAGTTACTACAGGTTTCGG 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico     181 GCCCGCTACTGGAAAATCGAGAACAGTTACAAATTGCTCTGCAGTTACTACAGGTTTCGG 239


10026R-2.IR full       241 GAGCAGAACAAAAGCTTTTATGAGAAGGTTCGTCCTCTGGACCTGAGACATGTTGGGCAA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico     241 GAGCAGAACAAAAGCTTTTATGAGAAGGTTCGTCCTCTGGACCTGAGACATGTTGGGCAA 299


10026R-2.IR full       301 TCGGACATCCTGACAGTGA-TCCCTATCGGGATCAACATGGCCATAGGATACTCATCTAC 359
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico     301 TCGGACATCCTGACAGTGACTCCCTATCGGGATCAACATGGCCATAGGATACTCATCTAC 359


10026R-2.IR full       361 CGATTCGGACTGTGGCGACCCAATCAAGTAACCGTCGACGATATATTTCGCGCCACCATT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico     361 CGATTCGGACTGTGGCGACCCAATCAAGTAACCGTCGACGATATATTTCGCGCCACCATT 419


10026R-2.IR full       421 GTCCTGCAGGAACTGGGCAGCCTGGAACCCATCTCACAGATTGTCGGAGGAGTGGGAATA 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10026R-2.in silico     421 GTCCTGCAGGAACTGGGCAGCCTGGAACCCATCTCACAGATTGTCGGAGGAGTGGGAATA 479


10026R-2.IR full       481 TTCGATCTGAAGGACCTGGG 499
                           ||||||||||||||||||||
10026R-2.in silico     481 TTCGATCTGAAGGACCTGGG 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.