National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10021R-3 
 Symbol bowl  Full Name brother of odd with entrails limited 
 CG No CG10021  Old CG No CG10021 
 Synonyms Bowl, 17-29-5, Su(tor)2-1, l(2)c, org2, CG10021, bowl 
 Accession No (Link to NCBI) NM_164556.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGAGCCGGAAGTTTTCCATTTCCACCAGGAGCCGCCGCCGCAGCTCTATTTCCACCTGGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGGGTCCTGGAATGCATGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTCGGGCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCGCGGCCTAAAAAACAGTTCATCTGCAAGTTCTGCAATCGACAATTCACCAAGTCGTAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AATCTGCTCATCCACGAGAGGACACACACGGACGAGCGGCCCTATTCCTGTGATATCTGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGATCACAGGTATATTCACTCCAAGGAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAACCCTTCAAATGCACGGAATGCGGCAAGGGATTCTGCCAATCGAGAACCTTGGCTGTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CACAAGATCCTGCACATGGAGGAATCACCCCACAAGTGCCCCGTCTGCAGTCGATCATTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AATCAGCGCTCCAACCTGAAGACCCATCTGCTCACCCACACGGATCACAAGCCCTACGAG 480

10021R-3.IR_full       481 TGCTCTTCATGCGGCAAAGT 500
                           |||||||||||||||||||| silico     481 TGCTCTTCATGCGGCAAAGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
100   482  NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
100   482  NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
100   482  NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
3.11   15  43  94  107  NM_057534.3  CG3242-RA (sob), mRNA 
2.28   11  22  54  76  NM_164546.1  CG3851-RA (odd), mRNA 
0.41   14  NM_142622.1  CG4360-RA (CG4360), mRNA 
0.2   NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0.2   26  34  NM_132218.1  CG2120-RA (CG2120), mRNA 
0.2   NM_136653.3  CG1884-RA, transcript variant A (Not1), mRNA 
0.2   NM_165678.2  CG1884-RB, transcript variant B (Not1), mRNA 
0   NM_164729.1  CG9100-RC, transcript variant C (Rab30), mRNA 
0   NM_164728.1  CG9100-RA, transcript variant A (Rab30), mRNA 
0   NM_135250.2  CG9100-RB, transcript variant B (Rab30), mRNA 
0   NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0   NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0   NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 
0   NM_169504.1  CG32473-RC, transcript variant C (CG32473), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   30  NM_134787.2  CG31670-RA (CG31670), mRNA 
0   NM_136928.3  CG8502-RA, transcript variant A (CG8502), mRNA 
0   NM_165892.2  CG8502-RC, transcript variant C (CG8502), mRNA 
0   18  NM_169411.2  CG6808-RA (CG6808), mRNA 
0   16  NM_141837.1  CG14711-RA (CG14711), mRNA 
0   NM_176061.2  CG10263-RD, transcript variant D (CG10263), mRNA 
0   NM_136149.2  CG10263-RA, transcript variant A (CG10263), mRNA 
0   NM_165312.1  CG10263-RC, transcript variant C (CG10263), mRNA 
0   NM_143156.2  CG4730-RA (CG4730), mRNA 
0   NM_168711.2  CG6664-RD, transcript variant D (CG6664), mRNA 
0   NM_168709.3  CG6664-RB, transcript variant B (CG6664), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.