National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10021R-2 
 Symbol bowl  Full Name brother of odd with entrails limited 
 CG No CG10021  Old CG No CG10021 
 Synonyms Bowl, 17-29-5, Su(tor)2-1, l(2)c, org2, CG10021, bowl 
 Accession No (Link to NCBI) NM_164556.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGCCGGAAGTTTTCCATTT 
 Primer Seq. 3'
aatctagaggtaccACTTTGCCGCATGAAGAGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGCCGGAA GTTTTCCATT TCCACCAGGA GCCGCCGCCG CAGCTCTATT TCCACCTGGC 
0061 CTGGGTCCTG GAATGCATGC CGGACTCGAT AGGCGCCTGC TACGTGCTCC TGGTCGGGCA 
0121 TCGCGGCCTA AAAAACAGTT CATCTGCAAG TTCTGCAATC GACAATTCAC CAAGTCGTAC 
0181 AATCTGCTCA TCCACGAGAG GACACACACG GACGAGCGGC CCTATTCCTG TGATATCTGC 
0241 GGCAAGGCGT TCCGGCGACA GGATCACCTG AGGGATCACA GGTATATTCA CTCCAAGGAG 
0301 AAACCCTTCA AATGCACGGA ATGCGGCAAG GGATTCTGCC AATCGAGAAC CTTGGCTGTC 
0361 CACAAGATCC TGCACATGGA GGAATCACCC CACAAGTGCC CCGTCTGCAG TCGATCATTC 
0421 AATCAGCGCT CCAACCTGAA GACCCATCTG CTCACCCACA CGGATCACAA GCCCTACGAG 
0481 TGCTCTTCAT GCGGCAAAGT  
 in silico PCR Fragment
0001 GGAGCCGGAA GTTTTCCATT TCCACCAGGA GCCGCCGCCG CAGCTCTATT TCCACCTGGC 
0061 CTGGGTCCTG GAATGCATGC CGGACTCGAT AGGCGCCTGC TACGTGCTCC TGGTCGGGCA 
0121 TCGCGGCCTA AAAAACAGTT CATCTGCAAG TTCTGCAATC GACAATTCAC CAAGTCGTAC 
0181 AATCTGCTCA TCCACGAGAG GACACACACG GACGAGCGGC CCTATTCCTG TGATATCTGC 
0241 GGCAAGGCGT TCCGGCGACA GGATCACCTG AGGGATCACA GGTATATTCA CTCCAAGGAG 
0301 AAACCCTTCA AATGCACGGA ATGCGGCAAG GGATTCTGCC AATCGAGAAC CTTGGCTGTC 
0361 CACAAGATCC TGCACATGGA GGAATCACCC CACAAGTGCC CCGTCTGCAG TCGATCATTC 
0421 AATCAGCGCT CCAACCTGAA GACCCATCTG CTCACCCACA CGGATCACAA GCCCTACGAG 
0481 TGCTCTTCAT GCGGCAAAGT  
 Assemble Data

10021R-2.IR_full       1   GGAGCCGGAAGTTTTCCATTTCCACCAGGAGCCGCCGCCGCAGCTCTATTTCCACCTGGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     1   GGAGCCGGAAGTTTTCCATTTCCACCAGGAGCCGCCGCCGCAGCTCTATTTCCACCTGGC 60


10021R-2.IR_full       61  CTGGGTCCTGGAATGCATGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTCGGGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     61  CTGGGTCCTGGAATGCATGCCGGACTCGATAGGCGCCTGCTACGTGCTCCTGGTCGGGCA 120


10021R-2.IR_full       121 TCGCGGCCTAAAAAACAGTTCATCTGCAAGTTCTGCAATCGACAATTCACCAAGTCGTAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     121 TCGCGGCCTAAAAAACAGTTCATCTGCAAGTTCTGCAATCGACAATTCACCAAGTCGTAC 180


10021R-2.IR_full       181 AATCTGCTCATCCACGAGAGGACACACACGGACGAGCGGCCCTATTCCTGTGATATCTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     181 AATCTGCTCATCCACGAGAGGACACACACGGACGAGCGGCCCTATTCCTGTGATATCTGC 240


10021R-2.IR_full       241 GGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGATCACAGGTATATTCACTCCAAGGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     241 GGCAAGGCGTTCCGGCGACAGGATCACCTGAGGGATCACAGGTATATTCACTCCAAGGAG 300


10021R-2.IR_full       301 AAACCCTTCAAATGCACGGAATGCGGCAAGGGATTCTGCCAATCGAGAACCTTGGCTGTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     301 AAACCCTTCAAATGCACGGAATGCGGCAAGGGATTCTGCCAATCGAGAACCTTGGCTGTC 360


10021R-2.IR_full       361 CACAAGATCCTGCACATGGAGGAATCACCCCACAAGTGCCCCGTCTGCAGTCGATCATTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     361 CACAAGATCCTGCACATGGAGGAATCACCCCACAAGTGCCCCGTCTGCAGTCGATCATTC 420


10021R-2.IR_full       421 AATCAGCGCTCCAACCTGAAGACCCATCTGCTCACCCACACGGATCACAAGCCCTACGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10021R-2.in silico     421 AATCAGCGCTCCAACCTGAAGACCCATCTGCTCACCCACACGGATCACAAGCCCTACGAG 480


10021R-2.IR_full       481 TGCTCTTCATGCGGCAAAGT 500
                           ||||||||||||||||||||
10021R-2.in silico     481 TGCTCTTCATGCGGCAAAGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
100   482  NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
100   482  NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
100   482  NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
3.11   15  43  94  107  NM_057534.3  CG3242-RA (sob), mRNA 
2.28   11  22  54  76  NM_164546.1  CG3851-RA (odd), mRNA 
0.41   14  NM_142622.1  CG4360-RA (CG4360), mRNA 
0.2   NM_139725.2  CG5249-RA (Blimp-1), mRNA 
0.2   26  34  NM_132218.1  CG2120-RA (CG2120), mRNA 
0.2   NM_136653.3  CG1884-RA, transcript variant A (Not1), mRNA 
0.2   NM_165678.2  CG1884-RB, transcript variant B (Not1), mRNA 
0   NM_164729.1  CG9100-RC, transcript variant C (Rab30), mRNA 
0   NM_164728.1  CG9100-RA, transcript variant A (Rab30), mRNA 
0   NM_135250.2  CG9100-RB, transcript variant B (Rab30), mRNA 
0   NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0   NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0   NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 
0   NM_169504.1  CG32473-RC, transcript variant C (CG32473), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   30  NM_134787.2  CG31670-RA (CG31670), mRNA 
0   NM_136928.3  CG8502-RA, transcript variant A (CG8502), mRNA 
0   NM_165892.2  CG8502-RC, transcript variant C (CG8502), mRNA 
0   18  NM_169411.2  CG6808-RA (CG6808), mRNA 
0   16  NM_141837.1  CG14711-RA (CG14711), mRNA 
0   NM_176061.2  CG10263-RD, transcript variant D (CG10263), mRNA 
0   NM_136149.2  CG10263-RA, transcript variant A (CG10263), mRNA 
0   NM_165312.1  CG10263-RC, transcript variant C (CG10263), mRNA 
0   NM_143156.2  CG4730-RA (CG4730), mRNA 
0   NM_168711.2  CG6664-RD, transcript variant D (CG6664), mRNA 
0   NM_168709.3  CG6664-RB, transcript variant B (CG6664), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.