National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10018R-2 
 Symbol Snm1  Full Name Snm1 
 CG No CG10018  Old CG No CG10018 
 Synonyms mus322, SNM1, CG10018, Snm1 
 Accession No (Link to NCBI) NM_141291.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTAGAACCGGACCCAACGC 
 Primer Seq. 3'
aatctagaggtaccTTCACAGGGAGAGGCTATCGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTAGAACC GGACCCAACG CCCACGATCG AGAACAGAAC GCCGGACAAG AAAAGAGCGG 
0061 GAAGAACTAN GTGCGGCTTC CACGACAAAA AAGGTCCGAC CAAAGACGGA AGCATGTCCA 
0121 ATCATAGCCA GCACTGCGTN TCAACGCGTT CCAGCAAGAA GACTCCGCTG CCAGGACAAA 
0181 TGCGCATCGA TAGCTTTTTT ACAAGTGCCG TCAAGAACTA CAAAGTCAAG TCAAGTTCCT 
0241 CTTGCAGGAA GGTGGATCCT CCGTTGGACA AGCGAAAGGT ATCTACCANA ggGNGCAAGC 
0301 GcCTCTTCGA GGAGTCTACA ACAACCTCAT CTGcCTTTAC GGGCAAGCTG GATGcAAAGC 
0361 CGTCAGAGAA GCGAGTGCAG CCTANTCGCC GTGCGAAAGG CAAGGAGAAC GCTAGCCTCT 
0421 CCGAAGTGCA CGTAATTGAC CTGTGCTCCG AGGACGAGCA GACCATAAAA AGAAAGCCAT 
0481 CCGCGATAGC CTCTCCCTGT GAA 
 in silico PCR Fragment
0001 ATGTAGAACC GGACCCAACG CCCACGATCG AGAACAGAAC GCCGGACAAG AAAAGAGCGG 
0061 GAAGAACT-C GTGCGGCTTC CACGACAAAA AAGGTCCGAC CAAAGACGGA AGCATGTCCA 
0121 ATCATAGCCA GCACTGCGT- TCAA-GCGTT CCAGCAAGAA GACTCCGCTG CCAGGACAAA 
0181 TGCGCATCGA TAGCTTTTTT ACAAGTGCCG TCAAGAACTA CAAAGTCAAG TCAAGTTCCT 
0241 CTTGCAGGAA GGTGGATCCT CCGTTGGACA AGCGAAAGGT ATCTACCAAA GGGCGCAAGC 
0301 GCCTCTTCGA GGAGTCTACA ACAACCTCAT CTGCCTTTAC GGGCAAGCTG GATGCAAAGC 
0361 CGTCAGAGAA GCGAGTGCAG CCTAGTCGCC GTGCGAAAGG CAAGGAGAAC GCTAGCCTCT 
0421 CCGAAGTGCA CGTAATTGAC CTGTGCTCCG AGGACGAGCA GACCATAAAA AGAAAGCCAT 
0481 CCGCGATAGC CTCTCCCTGT GAA 
 Assemble Data

10018R-2.IR_full       1   ATGTAGAACCGGACCCAACGCCCACGATCGAGAACAGAACGCCGGACAAGAAAAGAGCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10018R-2.in silico     1   ATGTAGAACCGGACCCAACGCCCACGATCGAGAACAGAACGCCGGACAAGAAAAGAGCGG 60


10018R-2.IR_full       61  GAAGAACTANGTGCGGCTTCCACGACAAAAAAGGTCCGACCAAAGACGGAAGCATGTCCA 120
                           ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
10018R-2.in silico     61  GAAGAACT-CGTGCGGCTTCCACGACAAAAAAGGTCCGACCAAAGACGGAAGCATGTCCA 120


10018R-2.IR_full       121 ATCATAGCCAGCACTGCGTNTCAACGCGTTCCAGCAAGAAGACTCCGCTGCCAGGACAAA 180
                           ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||
10018R-2.in silico     121 ATCATAGCCAGCACTGCGT-TCAA-GCGTTCCAGCAAGAAGACTCCGCTGCCAGGACAAA 180


10018R-2.IR_full       181 TGCGCATCGATAGCTTTTTTACAAGTGCCGTCAAGAACTACAAAGTCAAGTCAAGTTCCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10018R-2.in silico     181 TGCGCATCGATAGCTTTTTTACAAGTGCCGTCAAGAACTACAAAGTCAAGTCAAGTTCCT 240


10018R-2.IR_full       241 CTTGCAGGAAGGTGGATCCTCCGTTGGACAAGCGAAAGGTATCTACCANAGGGNGCAAGC 300
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||
10018R-2.in silico     241 CTTGCAGGAAGGTGGATCCTCCGTTGGACAAGCGAAAGGTATCTACCAAAGGGCGCAAGC 300


10018R-2.IR_full       301 GCCTCTTCGAGGAGTCTACAACAACCTCATCTGCCTTTACGGGCAAGCTGGATGCAAAGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10018R-2.in silico     301 GCCTCTTCGAGGAGTCTACAACAACCTCATCTGCCTTTACGGGCAAGCTGGATGCAAAGC 360


10018R-2.IR_full       361 CGTCAGAGAAGCGAGTGCAGCCTANTCGCCGTGCGAAAGGCAAGGAGAACGCTAGCCTCT 420
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
10018R-2.in silico     361 CGTCAGAGAAGCGAGTGCAGCCTAGTCGCCGTGCGAAAGGCAAGGAGAACGCTAGCCTCT 420


10018R-2.IR_full       421 CCGAAGTGCACGTAATTGACCTGTGCTCCGAGGACGAGCAGACCATAAAAAGAAAGCCAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10018R-2.in silico     421 CCGAAGTGCACGTAATTGACCTGTGCTCCGAGGACGAGCAGACCATAAAAAGAAAGCCAT 480


10018R-2.IR_full       481 CCGCGATAGCCTCTCCCTGTGAA 503
                           |||||||||||||||||||||||
10018R-2.in silico     481 CCGCGATAGCCTCTCCCTGTGAA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141291.2  CG10018-RA (Snm1), mRNA 
0   NM_135674.2  CG14937-RA (CG14937), mRNA 
0   NM_142494.2  CG7718-RA (CG7718), mRNA 
0   NM_141641.2  CG8149-RA (CG8149), mRNA 
0   NM_168114.2  CG32423-RC, transcript variant C (alan-shepard), mRNA 
0   NM_168112.1  CG32423-RB, transcript variant B (alan-shepard), mRNA 
0   NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
0   NM_168111.3  CG32423-RA, transcript variant A (alan-shepard), mRNA 
0   NM_142397.1  CG14318-RA (CG14318), mRNA 
0   NM_165563.2  CG30383-RA (CG30383), mRNA 
0   NM_132878.1  CG9216-RA, transcript variant A (CG9216), mRNA 
0   NM_167653.1  CG3400-RE, transcript variant E (Pfrx), mRNA 
0   NM_167655.1  CG3400-RH, transcript variant H (Pfrx), mRNA 
0   NM_167652.1  CG3400-RD, transcript variant D (Pfrx), mRNA 
0   NM_058103.2  CG3400-RG, transcript variant G (Pfrx), mRNA 
0   NM_058104.4  CG3400-RB, transcript variant B (Pfrx), mRNA 
0   NM_167656.1  CG3400-RI, transcript variant I (Pfrx), mRNA 
0   NM_167651.1  CG3400-RA, transcript variant A (Pfrx), mRNA 
0   NM_167654.1  CG3400-RF, transcript variant F (Pfrx), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_079150.2  CG13892-RA (Cypl), mRNA 
0   NM_079393.2  CG4083-RA (Mo25), mRNA 
0   NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_134832.2  CG15390-RA (CG15390), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_079024.2  CG10246-RA (Cyp6a9), mRNA 
0   NM_136798.1  CG30021-RA (skf), mRNA 
0   NM_141283.2  CG12162-RA, transcript variant A (CG12162), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.