National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10014R-4 
 Symbol CG10014  Full Name CG10014 
 CG No CG10014  Old CG No CG10014 
 Synonyms CG10014 
 Accession No (Link to NCBI) NM_141907.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GATGTGGACATCCTAGAGGAGCTGCTGCAGAAGTGCAAGTTTACCGACGAGGAGCTGGTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGTCACGGCCGGCCATCGAGAGTGCCTACAAGCGCTTCGTGGACGCCTATATGTCCGCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAACGTGGAGCCGATGGAACGGAGCTACTCTACCAGTACTTCCGGGACAGGGAACTGAAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGTATCAACGAGGCCATGCGCAACCAGGCAGCCATCACGATCCAGGCGGCTTGGCGAGGA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TACTGGGTTCGCCTCCAGTTCCCGCAAGAAGTTTGCGTTTGTGTCTGCGCAGCGGAAAAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAGGACGACGGGGAGGAAAAGCGCAGGGAACAGGCAGCGAGCGTTCTTCAGAGATTCTTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGCAAGGTTATGTTGCGCGTGGTTACCAAGCCAATCGTAGACCCCTGTGCCGAACCAACG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAACCAACTGAAGTGGATGCTAGCTCTTCACCGGATACAGCAAAGGATGGCTATGACGAC 480

10014R-4.IR_full       481 GTAAATCTCTCGACAGTACC 500
                           |||||||||||||||||||| silico     481 GTAAATCTCTCGACAGTACC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141907.2  CG10014-RA (CG10014), mRNA 
0   NM_141825.1  CG14708-RA (CG14708), mRNA 
0   NM_078870.2  CG7157-RA (Acp36DE), mRNA 
0   NM_137555.2  CG7097-RB, transcript variant B (CG7097), mRNA 
0   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_139844.2  CG8606-RA, transcript variant A (RhoGEF4), mRNA 
0   NM_168199.1  CG8606-RB, transcript variant B (RhoGEF4), mRNA 
0   NM_079861.2  CG1455-RA (CanA1), mRNA 
0   NM_167847.1  CG18214-RC, transcript variant C (trio), mRNA 
0   NM_143703.2  CG18214-RA, transcript variant A (trio), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   NM_138001.2  CG17658-RA (CG17658), mRNA 
0   NM_001043313.1  CG34155-RA (CG34155), mRNA 
0   NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0   NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0   NM_057714.3  CG12296-RA (klu), mRNA 
0   NM_135705.2  CG6618-RB, transcript variant B (Patsas), mRNA 
0   NM_164993.1  CG6618-RA, transcript variant A (Patsas), mRNA 
0   NM_135219.2  CG11329-RA (CG11329), mRNA 
0   NM_166971.1  CG32498-RL, transcript variant L (dnc), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_143692.2  CG2999-RA, transcript variant A (unc-13), mRNA 
0   NM_166793.2  CG2999-RC, transcript variant C (unc-13), mRNA 
0   NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0   NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0   NM_142956.1  CG18428-RA (CG18428), mRNA 
0   NM_079682.2  CG7411-RA (ort), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.