National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Temporarily suspending orders:

For system maintenance, the order acceptance will be suspended from 9:00 17th March 2019 to 20:00.

We apologize for the inconvenience.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10014R-2 
 Symbol CG10014  Full Name CG10014 
 CG No CG10014  Old CG No CG10014 
 Synonyms CG10014 
 Accession No (Link to NCBI) NM_141907.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGTGGACATCCTAGAGGAG 
 Primer Seq. 3'
aatctagaggtaccGGTACTGTCGAGAGATTTACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATGTGGACA TCCTAGAGGA GCTGCTGCAG AAGTGCAAGT TTACCGACGA GGAGCTGGTC 
0061 ATGTCACGGC CGGCCATCGA GAGTGCCTAC AAGCGCTTCG TGGACGCCTA TATGTCCGCC 
0121 GAACGTGGAG CCGATGGAAC GGAGCTACTC TACCAGTACT TCCGGGACAG GGAACTGAAG 
0181 CGTATCAACG AGGCCATGCG CAACCAGGCA GCCATCACGA TCCAGGCGGC TTGGCGAGGA 
0241 TACTGGGTTC GCCTCCAGTT CCCGCAAGAA GTTTGCGTTT GTGTCTGCGC AGCGGAAAAA 
0301 GAGGACGACG GGGAGGAAAA GCGCAGGGAA CAGGCAGCGA GCGTTCTTCA GAGATTCTTC 
0361 CGCAAGGTTA TGTTGCGCGT GGTTACCAAG CCAATCGTAG ACCCCTGTGC CGAACCAACG 
0421 GAACCAACTG AAGTGGATGC TAGCTCTTCA CCGGATACAG CAAAGGATGG CTATGACGAC 
0481 GTAAATCTCT CGACAGTACC  
 in silico PCR Fragment
0001 GATGTGGACA TCCTAGAGGA GCTGCTGCAG AAGTGCAAGT TTACCGACGA GGAGCTGGTC 
0061 ATGTCACGGC CGGCCATCGA GAGTGCCTAC AAGCGCTTCG TGGACGCCTA TATGTCCGCC 
0121 GAACGTGGAG CCGATGGAAC GGAGCTACTC TACCAGTACT TCCGGGACAG GGAACTGAAG 
0181 CGTATCAACG AGGCCATGCG CAACCAGGCA GCCATCACGA TCCAGGCGGC TTGGCGAGGA 
0241 TACTGGGTTC GCCTCCAGTT CCCGCAAGAA GTTTGCGTTT GTGTCTGCGC AGCGGAAAAA 
0301 GAGGACGACG GGGAGGAAAA GCGCAGGGAA CAGGCAGCGA GCGTTCTTCA GAGATTCTTC 
0361 CGCAAGGTTA TGTTGCGCGT GGTTACCAAG CCAATCGTAG ACCCCTGTGC CGAACCAACG 
0421 GAACCAACTG AAGTGGATGC TAGCTCTTCA CCGGATACAG CAAAGGATGG CTATGACGAC 
0481 GTAAATCTCT CGACAGTACC  
 Assemble Data

10014R-2.IR_full       1   GATGTGGACATCCTAGAGGAGCTGCTGCAGAAGTGCAAGTTTACCGACGAGGAGCTGGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     1   GATGTGGACATCCTAGAGGAGCTGCTGCAGAAGTGCAAGTTTACCGACGAGGAGCTGGTC 60


10014R-2.IR_full       61  ATGTCACGGCCGGCCATCGAGAGTGCCTACAAGCGCTTCGTGGACGCCTATATGTCCGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     61  ATGTCACGGCCGGCCATCGAGAGTGCCTACAAGCGCTTCGTGGACGCCTATATGTCCGCC 120


10014R-2.IR_full       121 GAACGTGGAGCCGATGGAACGGAGCTACTCTACCAGTACTTCCGGGACAGGGAACTGAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     121 GAACGTGGAGCCGATGGAACGGAGCTACTCTACCAGTACTTCCGGGACAGGGAACTGAAG 180


10014R-2.IR_full       181 CGTATCAACGAGGCCATGCGCAACCAGGCAGCCATCACGATCCAGGCGGCTTGGCGAGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     181 CGTATCAACGAGGCCATGCGCAACCAGGCAGCCATCACGATCCAGGCGGCTTGGCGAGGA 240


10014R-2.IR_full       241 TACTGGGTTCGCCTCCAGTTCCCGCAAGAAGTTTGCGTTTGTGTCTGCGCAGCGGAAAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     241 TACTGGGTTCGCCTCCAGTTCCCGCAAGAAGTTTGCGTTTGTGTCTGCGCAGCGGAAAAA 300


10014R-2.IR_full       301 GAGGACGACGGGGAGGAAAAGCGCAGGGAACAGGCAGCGAGCGTTCTTCAGAGATTCTTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     301 GAGGACGACGGGGAGGAAAAGCGCAGGGAACAGGCAGCGAGCGTTCTTCAGAGATTCTTC 360


10014R-2.IR_full       361 CGCAAGGTTATGTTGCGCGTGGTTACCAAGCCAATCGTAGACCCCTGTGCCGAACCAACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     361 CGCAAGGTTATGTTGCGCGTGGTTACCAAGCCAATCGTAGACCCCTGTGCCGAACCAACG 420


10014R-2.IR_full       421 GAACCAACTGAAGTGGATGCTAGCTCTTCACCGGATACAGCAAAGGATGGCTATGACGAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10014R-2.in silico     421 GAACCAACTGAAGTGGATGCTAGCTCTTCACCGGATACAGCAAAGGATGGCTATGACGAC 480


10014R-2.IR_full       481 GTAAATCTCTCGACAGTACC 500
                           ||||||||||||||||||||
10014R-2.in silico     481 GTAAATCTCTCGACAGTACC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141907.2  CG10014-RA (CG10014), mRNA 
0   NM_141825.1  CG14708-RA (CG14708), mRNA 
0   NM_078870.2  CG7157-RA (Acp36DE), mRNA 
0   NM_137555.2  CG7097-RB, transcript variant B (CG7097), mRNA 
0   NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_139844.2  CG8606-RA, transcript variant A (RhoGEF4), mRNA 
0   NM_168199.1  CG8606-RB, transcript variant B (RhoGEF4), mRNA 
0   NM_079861.2  CG1455-RA (CanA1), mRNA 
0   NM_167847.1  CG18214-RC, transcript variant C (trio), mRNA 
0   NM_143703.2  CG18214-RA, transcript variant A (trio), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   NM_138001.2  CG17658-RA (CG17658), mRNA 
0   NM_001043313.1  CG34155-RA (CG34155), mRNA 
0   NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0   NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0   NM_057714.3  CG12296-RA (klu), mRNA 
0   NM_135705.2  CG6618-RB, transcript variant B (Patsas), mRNA 
0   NM_164993.1  CG6618-RA, transcript variant A (Patsas), mRNA 
0   NM_135219.2  CG11329-RA (CG11329), mRNA 
0   NM_166971.1  CG32498-RL, transcript variant L (dnc), mRNA 
0   NM_132413.1  CG15295-RA (CG15295), mRNA 
0   NM_143692.2  CG2999-RA, transcript variant A (unc-13), mRNA 
0   NM_166793.2  CG2999-RC, transcript variant C (unc-13), mRNA 
0   NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0   NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0   NM_142956.1  CG18428-RA (CG18428), mRNA 
0   NM_079682.2  CG7411-RA (ort), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
DC
++ 
DM
++ 
VM
VB
+- 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
++   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.