National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10013R-1 
 Symbol CG10013  Full Name CG10013 
 CG No CG10013  Old CG No CG10013 
 Synonyms CG10013 
 Accession No (Link to NCBI) NM_141918.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCCCTACTGGTCGAGAGTTC 
 Primer Seq. 3'
aatctagaggtaccCGATGGTCTTGACTCCGTTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCCCTACTG GTCGAGAGTT CCAATGTGTC CCAATTGATA GAGGTCAGCC CCAATGGGAT 
0061 CAGTTGGCAC GAGAAGAACG TGGAGTACCG CATCATAATG GACGAGTTCT TCGATATAAT 
0121 CACCAGGACG AATGCTGGCG ACGTGCCCAT TACCTTAGTC GAAATGAAGG GTAGTCATGT 
0181 GTCATTTGGA TTATATCTCC GTAGGATTAG GTACAGCATT TTGGATGCGC TCACCATTAA 
0241 TGTGGAACTG GGGGAGCTGC CAATGTGTAT TTCCCCATAC AATTCCTGTT CCCTGCACTG 
0301 CAGCAACTGT ACGAATGAAA TCATTGGGCA AAGGCAGTAT TATCATATCC AGGAGGTTCC 
0361 GATAACGACC ATCTTGCCGC AGAACTACTT CTGTCCCCGC AACAGGATCC CAGTGTATCC 
0421 TTCGGAGGAG GAGCTCTATT ACGGCCTCAA CTATCTGGTC GTATGCTCCG AGCTGCTCGG 
0481 CAACGGAGTC AAGACCATCG  
 in silico PCR Fragment
0001 ACCCCTACTG GTCGAGAGTT CCAATGTGTC CCAATTGATA GAGGTCAGCC CCAATGGGAT 
0061 CAGTTGGCAC GAGAAGAACG TGGAGTACCG CATCATAATG GACGAGTTCT TCGATATAAT 
0121 CACCAGGACG AATGCTGGCG ACGTGCCCAT TACCTTAGTC GAAATGAAGG GTAGTCATGT 
0181 GTCATTTGGA TTATATCTCC GTAGGATTAG GTACAGCATT TTGGATGCGC TCACCATTAA 
0241 TGTGGAACTG GGGGAGCTGC CAATGTGTAT TTCCCCATAC AATTCCTGTT CCCTGCACTG 
0301 CAGCAACTGT ACGAATGAAA TCATTGGGCA AAGGCAGTAT TATCATATCC AGGAGGTTCC 
0361 GATAACGACC ATCTTGCCGC AGAACTACTT CTGTCCCCGC AACAGGATCC CAGTGTATCC 
0421 TTCGGAGGAG GAGCTCTATT ACGGCCTCAA CTATCTGGTC GTATGCTCCG AGCTGCTCGG 
0481 CAACGGAGTC AAGACCATCG  
 Assemble Data

10013R-1.IR_full       1   ACCCCTACTGGTCGAGAGTTCCAATGTGTCCCAATTGATAGAGGTCAGCCCCAATGGGAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     1   ACCCCTACTGGTCGAGAGTTCCAATGTGTCCCAATTGATAGAGGTCAGCCCCAATGGGAT 60


10013R-1.IR_full       61  CAGTTGGCACGAGAAGAACGTGGAGTACCGCATCATAATGGACGAGTTCTTCGATATAAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     61  CAGTTGGCACGAGAAGAACGTGGAGTACCGCATCATAATGGACGAGTTCTTCGATATAAT 120


10013R-1.IR_full       121 CACCAGGACGAATGCTGGCGACGTGCCCATTACCTTAGTCGAAATGAAGGGTAGTCATGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     121 CACCAGGACGAATGCTGGCGACGTGCCCATTACCTTAGTCGAAATGAAGGGTAGTCATGT 180


10013R-1.IR_full       181 GTCATTTGGATTATATCTCCGTAGGATTAGGTACAGCATTTTGGATGCGCTCACCATTAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     181 GTCATTTGGATTATATCTCCGTAGGATTAGGTACAGCATTTTGGATGCGCTCACCATTAA 240


10013R-1.IR_full       241 TGTGGAACTGGGGGAGCTGCCAATGTGTATTTCCCCATACAATTCCTGTTCCCTGCACTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     241 TGTGGAACTGGGGGAGCTGCCAATGTGTATTTCCCCATACAATTCCTGTTCCCTGCACTG 300


10013R-1.IR_full       301 CAGCAACTGTACGAATGAAATCATTGGGCAAAGGCAGTATTATCATATCCAGGAGGTTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     301 CAGCAACTGTACGAATGAAATCATTGGGCAAAGGCAGTATTATCATATCCAGGAGGTTCC 360


10013R-1.IR_full       361 GATAACGACCATCTTGCCGCAGAACTACTTCTGTCCCCGCAACAGGATCCCAGTGTATCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     361 GATAACGACCATCTTGCCGCAGAACTACTTCTGTCCCCGCAACAGGATCCCAGTGTATCC 420


10013R-1.IR_full       421 TTCGGAGGAGGAGCTCTATTACGGCCTCAACTATCTGGTCGTATGCTCCGAGCTGCTCGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10013R-1.in silico     421 TTCGGAGGAGGAGCTCTATTACGGCCTCAACTATCTGGTCGTATGCTCCGAGCTGCTCGG 480


10013R-1.IR_full       481 CAACGGAGTCAAGACCATCG 500
                           ||||||||||||||||||||
10013R-1.in silico     481 CAACGGAGTCAAGACCATCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141918.1  CG10013-RA (CG10013), mRNA 
0   NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
0   NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
0   NM_141785.1  CG4706-RA (CG4706), mRNA 
0   NM_142334.1  CG3995-RA (CG3995), mRNA 
0   NM_133107.1  CG7326-RA (CG7326), mRNA 
0   NM_136538.2  CG30359-RA (CG30359), mRNA 
0   NM_140494.1  CG13457-RB, transcript variant B (CG13457), mRNA 
0   NM_168610.1  CG13457-RA, transcript variant A (CG13457), mRNA 
0   NM_138261.2  CG9166-RA (312), mRNA 
0   NM_079052.2  CG4909-RA (POSH), mRNA 
0   NM_164950.1  CG31723-RA (CG31723), mRNA 
0   NM_132713.1  CG11584-RB (CG11584), mRNA 
0   NM_206419.1  CG32438-RD, transcript variant D (Smc5), mRNA 
0   NM_141077.3  CG32438-RA, transcript variant A (Smc5), mRNA 
0   NM_079505.2  CG1119-RA, transcript variant A (Gnf1), mRNA 
0   NM_168924.2  CG32438-RB, transcript variant B (Smc5), mRNA 
0   NM_001014605.1  CG1119-RB, transcript variant B (Gnf1), mRNA 
0   NM_143699.2  CG11352-RC, transcript variant C (jim), mRNA 
0   NM_001014601.1  CG11352-RD, transcript variant D (jim), mRNA 
0   NM_168964.2  CG11352-RB, transcript variant B (jim), mRNA 
0   NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_139691.1  CG10673-RA (CG10673), mRNA 
0   NM_166134.2  CG8395-RA (Rrp42), mRNA 
0   NM_141925.1  CG10035-RA (CG10035), mRNA 
0   NM_165891.1  CG30045-RA (CG30045), mRNA 
0   NM_001031999.1  CG17117-RF, transcript variant F (hth), mRNA 
0   NM_141706.1  CG5358-RA (Art4), mRNA 
0   NM_169704.1  CG32855-RA (CG32855), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.