National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10011R-3 
 Symbol CG10011  Full Name CG10011 
 CG No CG10011  Old CG No CG10011 
 Synonyms CG10011 
 Accession No (Link to NCBI) NM_143367.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAACTTTCTCAAGGACACCAC 
 Primer Seq. 3'
aatctagaggtaccTTGAGCTCGATATAGCCGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAACTTTCTC AAGGACACCA CGCAGTTGCA GAAGAAGTTG GAGATCACCG GACGCGACTG 
0061 TCCCAACGCC AGTTTTTCGA ATTTGGCACG TGAGGAGCAC TTCGCCAATC TGGTGCAGCA 
0121 AAACTTTCCC CAGGACGTGG CCCACCATGC AAATGGTGAA ACCAATGGCG GATCAGCGCC 
0181 AGAGGAAGAT GGCCAAGAGG CAGCTGGTGG ATTGAAGACC CAGCCAACTG AGGATACCGA 
0241 TGGCAACCTG GAGGCTCTTA TGCAACGCAN AGGTGTCCCC GGACAAGGAG GTCAATGGAC 
0301 TGGTTCACAG TGCAGGCGTG GAGCCAAACA ATCGCATCGT GAGCACCGTT TACATCCACC 
0361 GCGAGTGGGT GCTAAAAAAG ATTGCCCTTT GCCTGGAGCA ACGAACGGCG GGAAAGAAGT 
0421 CAGGTCCCGT GGCTCTGAGA GGAGCAGCTT CCTCCAGTTA CGTATCTGCC CGGGCCAAGG 
0481 CTGCGGCTAT ATCGAGCTCA A 
 in silico PCR Fragment
0001 CAACTTTCTC AAGGACACCA CGCAGTTGCA GAAGAAGTTG GAGATCACCG GACGCGACTG 
0061 TCCCAACGCC AGTTTTTCGA ATTTGGCACG TGAGGAGCAC TTCGCCAATC TGGTGCAGCA 
0121 AAACTTTCCC CAGGACGTGG CCCACCATGC AAATGGTGAA ACCAATGGCG GATCAGCGCC 
0181 AGAGGAAGAT GGCCAAGAGG CAGCTGGTGG ATTGAAGACC CAGCCAACTG AGGATACCGA 
0241 TGGCAACCTG GAGGCTCTTA TGCAACGCA- AGGTGTCCCC GGACAAGGAG GTCAATGGAC 
0301 TGGTTCACAG TGCAGGCGTG GAGCCAAACA ATCGCATCGT GAGCACCGTT TACATCCACC 
0361 GCGAGTGGGT GCTAAAAAAG ATTGCCCTTT GCCTGGAGCA ACGAACGGCG GGAAAGAAGT 
0421 CAGGTCCCGT GGCTCTGGGA GGAGCAGCTT CCTCCAGTTA CGTATCTGCC CGGGCCAAGG 
0481 CTGCGGCTAT ATCGAGCTCA A 
 Assemble Data

10011R-3.IR_full       1   CAACTTTCTCAAGGACACCACGCAGTTGCAGAAGAAGTTGGAGATCACCGGACGCGACTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     1   CAACTTTCTCAAGGACACCACGCAGTTGCAGAAGAAGTTGGAGATCACCGGACGCGACTG 60


10011R-3.IR_full       61  TCCCAACGCCAGTTTTTCGAATTTGGCACGTGAGGAGCACTTCGCCAATCTGGTGCAGCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     61  TCCCAACGCCAGTTTTTCGAATTTGGCACGTGAGGAGCACTTCGCCAATCTGGTGCAGCA 120


10011R-3.IR_full       121 AAACTTTCCCCAGGACGTGGCCCACCATGCAAATGGTGAAACCAATGGCGGATCAGCGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     121 AAACTTTCCCCAGGACGTGGCCCACCATGCAAATGGTGAAACCAATGGCGGATCAGCGCC 180


10011R-3.IR_full       181 AGAGGAAGATGGCCAAGAGGCAGCTGGTGGATTGAAGACCCAGCCAACTGAGGATACCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     181 AGAGGAAGATGGCCAAGAGGCAGCTGGTGGATTGAAGACCCAGCCAACTGAGGATACCGA 240


10011R-3.IR_full       241 TGGCAACCTGGAGGCTCTTATGCAACGCANAGGTGTCCCCGGACAAGGAGGTCAATGGAC 300
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
10011R-3.in silico     241 TGGCAACCTGGAGGCTCTTATGCAACGCA-AGGTGTCCCCGGACAAGGAGGTCAATGGAC 300


10011R-3.IR_full       301 TGGTTCACAGTGCAGGCGTGGAGCCAAACAATCGCATCGTGAGCACCGTTTACATCCACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     301 TGGTTCACAGTGCAGGCGTGGAGCCAAACAATCGCATCGTGAGCACCGTTTACATCCACC 360


10011R-3.IR_full       361 GCGAGTGGGTGCTAAAAAAGATTGCCCTTTGCCTGGAGCAACGAACGGCGGGAAAGAAGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     361 GCGAGTGGGTGCTAAAAAAGATTGCCCTTTGCCTGGAGCAACGAACGGCGGGAAAGAAGT 420


10011R-3.IR_full       421 CAGGTCCCGTGGCTCTGAGAGGAGCAGCTTCCTCCAGTTACGTATCTGCCCGGGCCAAGG 480
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
10011R-3.in silico     421 CAGGTCCCGTGGCTCTGGGAGGAGCAGCTTCCTCCAGTTACGTATCTGCCCGGGCCAAGG 480


10011R-3.IR_full       481 CTGCGGCTATATCGAGCTCAA 501
                           |||||||||||||||||||||
10011R-3.in silico     481 CTGCGGCTATATCGAGCTCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143367.2  CG10011-RA (CG10011), mRNA 
0   NM_142486.2  CG7708-RA, transcript variant A (CG7708), mRNA 
0   NM_169832.1  CG7708-RB, transcript variant B (CG7708), mRNA 
0   NM_170321.1  CG31069-RA (spn-D), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_206766.1  CG9699-RG, transcript variant G (CG9699), mRNA 
0   NM_132919.2  CG9699-RC, transcript variant C (CG9699), mRNA 
0   NM_167531.1  CG9699-RB, transcript variant B (CG9699), mRNA 
0   NM_167533.1  CG9699-RE, transcript variant E (CG9699), mRNA 
0   NM_167532.1  CG9699-RD, transcript variant D (CG9699), mRNA 
0   NM_167534.1  CG9699-RF, transcript variant F (CG9699), mRNA 
0   NM_167530.1  CG9699-RA, transcript variant A (CG9699), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   NM_079297.2  CG6502-RA (E(z)), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
0   NM_078641.2  CG3606-RB, transcript variant B (caz), mRNA 
0   12  NM_206101.1  CG13168-RC, transcript variant C (CG13168), mRNA 
0   12  NM_206100.1  CG13168-RB, transcript variant B (CG13168), mRNA 
0   NM_001042910.1  CG11628-RB, transcript variant B (Grp1), mRNA 
0   NM_165123.2  CG3938-RC, transcript variant C (CycE), mRNA 
0   NM_057611.4  CG3938-RA, transcript variant A (CycE), mRNA 
0   NM_165125.2  CG3938-RE, transcript variant E (CycE), mRNA 
0   NM_165124.2  CG3938-RD, transcript variant D (CycE), mRNA 
0   NM_057612.4  CG3938-RB, transcript variant B (CycE), mRNA 
0   NM_136276.2  CG11628-RA, transcript variant A (Grp1), mRNA 
0   13  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   11  NM_167441.2  CG9176-RB, transcript variant B (cngl), mRNA 
0   NM_142980.2  CG5706-RA (CG5706), mRNA 
0   NM_137806.2  CG5465-RA (MED16), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.