National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10007R-4 
 Symbol Tango9  Full Name Transport and Golgi organization 9 
 CG No CG10007  Old CG No CG10007 
 Synonyms CG10007, TANGO9, Tango9 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTGTGCTCAGCGGCACCTTC 
 Primer Seq. 3'
aatctagaggtaccTAAGGCAACGTGACCAGGTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

10007R-4.IR full       1   TTTGTGCTCAGCGGCACCTTCAACGTTCTGGTGGTGAAGTGGGCCAATCAACAACAGGTA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     1   TTTGTGCTCAGCGGCACCTTCAACGTTCTGGTGGTGAAGTGGGCCAATCAACAACAGGTA 60


10007R-4.IR full       61  ATCGGCAGCGATGGAAAACTTCATGGATTTCAACATCCAGTGGTGTTCACACTGCTCATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     61  ATCGGCAGCGATGGAAAACTTCATGGATTTCAACATCCAGTGGTGTTCACACTGCTCATG 120


10007R-4.IR full       121 TTCCTGGGCGAGTTCCTGTGCTTTGCGGTCTTCAAGGTGATCCGCCTGATCTCCAATCGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     121 TTCCTGGGCGAGTTCCTGTGCTTTGCGGTCTTCAAGGTGATCCGCCTGATCTCCAATCGT 180


10007R-4.IR full       181 CGTGGAGTTATATCCGATCTGGATAGCATCTTGTCGCAGGACAGCAGTGAGTTCCGCCCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     181 CGTGGAGTTATATCCGATCTGGATAGCATCTTGTCGCAGGACAGCAGTGAGTTCCGCCCT 240


10007R-4.IR full       241 GTTAGCATGCTATTGCCCACTTTGCTGGATGCGGCAGCCTCCATTCTGTTGTTCACCGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     241 GTTAGCATGCTATTGCCCACTTTGCTGGATGCGGCAGCCTCCATTCTGTTGTTCACCGGA 300


10007R-4.IR full       301 CTTTACTTNACTTACGCCACCAGCTTTCAGATGATAAGAGGCGCCGCCCTGATCTTTGTG 360
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     301 CTTTACTTGACTTACGCCACCAGCTTTCAGATGATAAGAGGCGCCGCCCTGATCTTTGTG 360


10007R-4.IR full       361 GGCATCTTTAGCACCATGTTTCTGAATCACACGCTGACCGGACGGCACTGGCTGGCCATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     361 GGCATCTTTAGCACCATGTTTCTGAATCACACGCTGACCGGACGGCACTGGCTGGCCATC 420


10007R-4.IR full       421 TTTACGATATCGTGCGGCCTGCTGGACATTATCAGTCTGGACGTCCATCGCGTTGAATAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10007R-4.in silico     421 TTTACGATATCGTGCGGCCTGCTGGACATTATCAGTCTGGACGTCCATCGCGTTGAATAC 480


10007R-4.IR full       481 GACCTGGTCACGTTGCCTTA 500
                           ||||||||||||||||||||
10007R-4.in silico     481 GACCTGGTCACGTTGCCTTA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_141879.2  Transport and Golgi organization 9 CG10007-RA (Tango9), mRNA 
NM_170337.1  widerborst CG5643-RB, transcript variant B (wdb), mRNA 
NM_170338.1  widerborst CG5643-RD, transcript variant D (wdb), mRNA 
NM_170340.1  widerborst CG5643-RF, transcript variant F (wdb), mRNA 
NM_170341.1  widerborst CG5643-RG, transcript variant G (wdb), mRNA 
NM_170336.1  widerborst CG5643-RA, transcript variant A (wdb), mRNA 
NM_143312.2  widerborst CG5643-RC, transcript variant C (wdb), mRNA 
NM_170339.1  widerborst CG5643-RE, transcript variant E (wdb), mRNA 
NM_176716.2  CG7766-RB, transcript variant B (CG7766), mRNA 
NM_132297.4  CG7766-RA, transcript variant A (CG7766), mRNA 
NM_164502.1  synaptotagmin CG3139-RC, transcript variant C (syt), mRNA 
NM_078736.2  synaptotagmin CG3139-RA, transcript variant A (syt), mRNA 
NM_164501.1  synaptotagmin CG3139-RB, transcript variant B (syt), mRNA 
NM_205897.1  synaptotagmin CG3139-RD, transcript variant D (syt), mRNA 
NM_079000.2  Multi drug resistance 49 CG3879-RA (Mdr49), mRNA 
NM_001014599.1  Acetyl Coenzyme A synthase CG9390-RC, transcript variant C (AcCoAS), mRNA 
NM_168894.1  Acetyl Coenzyme A synthase CG9390-RA, transcript variant A (AcCoAS), mRNA 
NM_079472.2  Acetyl Coenzyme A synthase CG9390-RB, transcript variant B (AcCoAS), mRNA 
NM_132524.1  Cyp28c1 CG1895-RA (Cyp28c1), mRNA 
NM_132242.4  CG1636-RA (CG1636), mRNA 
NM_001014745.1  Adenylyl cyclase 35C CG9210-RB, transcript variant B (Ac13E), mRNA 
NM_057951.2  Adenylyl cyclase 35C CG9210-RA, transcript variant A (Ac13E), mRNA 
NM_139654.1  CG13722-RA (CG13722), mRNA 
NM_164842.1  rolling stone CG9552-RA (rost), mRNA 
10  20  NM_164808.2  CG31901-RA (CG31901), mRNA 
NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
NM_169574.1  suppressor of Hairy wing CG8573-RB, transcript variant B (su(Hw)), mRNA 
NM_079625.2  suppressor of Hairy wing CG8573-RA, transcript variant A (su(Hw)), mRNA 
NM_144399.1  CG18765-RA (CG18765), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.