National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10007R-2 
 Symbol Tango9  Full Name Transport and Golgi organization 9 
 CG No CG10007  Old CG No CG10007 
 Synonyms CG10007, TANGO9, Tango9 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
0001 tttgtgctca gcggcacctt caacgttctg gtggtgaagt gggccaatca acaacaggta 
0061 atcggcagcg atggaaaact tcatggattt caacatccag tggtgttcac actgctcatg 
0121 ttcctgggcg agttcctgtg ctttgcggtc ttcaaggtga tccgcctgat ctccaatcgt 
0181 cgtggagtta tatccgatct ggatagcatc ttgtcgcagg acagcagtga gttccgccct 
0241 gttagcatgc tattgcccac tttgctggat gcggcagcct ccattctgtt gttcaccgga 
0301 ctttacttga cttacgccac cagctttcag atgataagag gcgccgccct gatctttgtg 
0361 ggcatcttta gcaccatgtt tctgaatcac acgctgaccg gacggcactg gctggccatc 
0421 tttacgatat cgtgcggcct gctggacatt atcagtctgg acgtccatcg cgttgaatac 
0481 gacctggtca cgttgcctta  
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTGTGCTCAGCGGCACCTTCAACGTTCTGGTGGTGAAGTGGGCCAATCAACAACAGGTA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATCGGCAGCGATGGAAAACTTCATGGATTTCAACATCCAGTGGTGTTCACACTGCTCATG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCCTGGGCGAGTTCCTGTGCTTTGCGGTCTTCAAGGTGATCCGCCTGATCTCCAATCGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGTGGAGTTATATCCGATCTGGATAGCATCTTGTCGCAGGACAGCAGTGAGTTCCGCCCT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTTAGCATGCTATTGCCCACTTTGCTGGATGCGGCAGCCTCCATTCTGTTGTTCACCGGA 300

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTTTACTTGACTTACGCCACCAGCTTTCAGATGATAAGAGGCGCCGCCCTGATCTTTGTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCATCTTTAGCACCATGTTTCTGAATCACACGCTGACCGGACGGCACTGGCTGGCCATC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTTACGATATCGTGCGGCCTGCTGGACATTATCAGTCTGGACGTCCATCGCGTTGAATAC 480

10007R-2.IR full       481 GACCTGGTCACGTTGCCTTA 500
                           |||||||||||||||||||| silico     481 GACCTGGTCACGTTGCCTTA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_141879.2  Transport and Golgi organization 9 CG10007-RA (Tango9), mRNA 
NM_170337.1  widerborst CG5643-RB, transcript variant B (wdb), mRNA 
NM_170338.1  widerborst CG5643-RD, transcript variant D (wdb), mRNA 
NM_170340.1  widerborst CG5643-RF, transcript variant F (wdb), mRNA 
NM_170341.1  widerborst CG5643-RG, transcript variant G (wdb), mRNA 
NM_170336.1  widerborst CG5643-RA, transcript variant A (wdb), mRNA 
NM_143312.2  widerborst CG5643-RC, transcript variant C (wdb), mRNA 
NM_170339.1  widerborst CG5643-RE, transcript variant E (wdb), mRNA 
NM_176716.2  CG7766-RB, transcript variant B (CG7766), mRNA 
NM_132297.4  CG7766-RA, transcript variant A (CG7766), mRNA 
NM_164502.1  synaptotagmin CG3139-RC, transcript variant C (syt), mRNA 
NM_078736.2  synaptotagmin CG3139-RA, transcript variant A (syt), mRNA 
NM_164501.1  synaptotagmin CG3139-RB, transcript variant B (syt), mRNA 
NM_205897.1  synaptotagmin CG3139-RD, transcript variant D (syt), mRNA 
NM_079000.2  Multi drug resistance 49 CG3879-RA (Mdr49), mRNA 
NM_001014599.1  Acetyl Coenzyme A synthase CG9390-RC, transcript variant C (AcCoAS), mRNA 
NM_168894.1  Acetyl Coenzyme A synthase CG9390-RA, transcript variant A (AcCoAS), mRNA 
NM_079472.2  Acetyl Coenzyme A synthase CG9390-RB, transcript variant B (AcCoAS), mRNA 
NM_132524.1  Cyp28c1 CG1895-RA (Cyp28c1), mRNA 
NM_132242.4  CG1636-RA (CG1636), mRNA 
NM_001014745.1  Adenylyl cyclase 35C CG9210-RB, transcript variant B (Ac13E), mRNA 
NM_057951.2  Adenylyl cyclase 35C CG9210-RA, transcript variant A (Ac13E), mRNA 
NM_139654.1  CG13722-RA (CG13722), mRNA 
NM_164842.1  rolling stone CG9552-RA (rost), mRNA 
10  20  NM_164808.2  CG31901-RA (CG31901), mRNA 
NM_136777.2  CG30015-RB, transcript variant B (CG30015), mRNA 
NM_165802.1  CG30015-RA, transcript variant A (CG30015), mRNA 
NM_169574.1  suppressor of Hairy wing CG8573-RB, transcript variant B (su(Hw)), mRNA 
NM_079625.2  suppressor of Hairy wing CG8573-RA, transcript variant A (su(Hw)), mRNA 
NM_144399.1  CG18765-RA (CG18765), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.