National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10001R-1 
 Symbol AR-2  Full Name Allatostatin Receptor 2 
 CG No CG10001  Old CG No CG10001 
 Synonyms CG10001, D.AlstR2, DAR-2, DAR, anon-WO0170980.116, anon-WO0170980.115, anon-WO0131005.7, AR-2 
 Accession No (Link to NCBI) NM_079820.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCCATCACGGGATTCTTCG 
 Primer Seq. 3'
aatctagaggtaccGCTGATGAAGAAGGTGACCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGCCATCAC GGGATTCTTC GGCAACCTGC TGGTCATCCT GGTGGTGGTC TTCAACAACA 
0061 ACATGCGCTC CACCACCAAC CTGATGATTG TCAATCTGGC TGCCGCTGAT CTGATGTTCG 
0121 TAATCCTCTG CATTCCCTTC ACGGCCACCG ATTACATGGT GTACTACTGG CCATATGGAA 
0181 GGTTCTGGTG CCGCAGTGTC CAGTACCTGA TTGTGGTGAC CGCCTTCGCC TCCATCTACA 
0241 CGCTGGTGCT AATGTCCATC GATCGGTTCC TGGCGGTGGT TCATCCCATT CGCTCGCGGA 
0301 TGATGAGGAC GGAGAACATT ACCCTGATTG CCATCGTGAC TCTGTGGATC GTGGTGCTGG 
0361 TCGTTTCGGT GCCAGTGGCC TTCACCCACG ACGTGGTGGT GGATTACGAT GCAAAGAAGA 
0421 ACATCACCTA CGGCATGTGC ACCTTCACGA CGAACGACTT CCTTGGTCCG CGCACCTACC 
0481 AGGTCACCTT CTTCATCAGC  
 in silico PCR Fragment
0001 TCGCCATCAC GGGATTCTTC GGCAACCTGC TGGTCATCCT GGTGGTGGTC TTCAACAACA 
0061 ACATGCGCTC CACCACCAAC CTGATGATTG TCAATCTGGC TGCCGCTGAT CTGATGTTCG 
0121 TAATCCTCTG CATTCCCTTC ACGGCCACCG ATTACATGGT GTACTACTGG CCATATGGAA 
0181 GGTTCTGGTG CCGCAGTGTC CAGTACCTGA TTGTGGTGAC CGCCTTCGCC TCCATTTACA 
0241 CGCTGGTGCT GATGTCCATC GATCGGTTCC TGGCGGTGGT TCATCCCATT CGCTCGCGGA 
0301 TGATGAGGAC GGAGAACATT ACCCTGATTG CCATCGTGAC TCTGTGGATC GTGGTGCTGG 
0361 TCGTTTCGGT GCCAGTGGCC TTCACCCACG ACGTGGTGGT GGATTACGAT GCAAAGAAGA 
0421 ACATCACCTA CGGCATGTGC ACCTTCACGA CGAACGACTT CCTTGGTCCG CGCACCTACC 
0481 AGGTCACCTT CTTCATCAGC  
 Assemble Data

10001R-1.IR_full       1   TCGCCATCACGGGATTCTTCGGCAACCTGCTGGTCATCCTGGTGGTGGTCTTCAACAACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     1   TCGCCATCACGGGATTCTTCGGCAACCTGCTGGTCATCCTGGTGGTGGTCTTCAACAACA 60


10001R-1.IR_full       61  ACATGCGCTCCACCACCAACCTGATGATTGTCAATCTGGCTGCCGCTGATCTGATGTTCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     61  ACATGCGCTCCACCACCAACCTGATGATTGTCAATCTGGCTGCCGCTGATCTGATGTTCG 120


10001R-1.IR_full       121 TAATCCTCTGCATTCCCTTCACGGCCACCGATTACATGGTGTACTACTGGCCATATGGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     121 TAATCCTCTGCATTCCCTTCACGGCCACCGATTACATGGTGTACTACTGGCCATATGGAA 180


10001R-1.IR_full       181 GGTTCTGGTGCCGCAGTGTCCAGTACCTGATTGTGGTGACCGCCTTCGCCTCCATCTACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
10001R-1.in silico     181 GGTTCTGGTGCCGCAGTGTCCAGTACCTGATTGTGGTGACCGCCTTCGCCTCCATTTACA 240


10001R-1.IR_full       241 CGCTGGTGCTAATGTCCATCGATCGGTTCCTGGCGGTGGTTCATCCCATTCGCTCGCGGA 300
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     241 CGCTGGTGCTGATGTCCATCGATCGGTTCCTGGCGGTGGTTCATCCCATTCGCTCGCGGA 300


10001R-1.IR_full       301 TGATGAGGACGGAGAACATTACCCTGATTGCCATCGTGACTCTGTGGATCGTGGTGCTGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     301 TGATGAGGACGGAGAACATTACCCTGATTGCCATCGTGACTCTGTGGATCGTGGTGCTGG 360


10001R-1.IR_full       361 TCGTTTCGGTGCCAGTGGCCTTCACCCACGACGTGGTGGTGGATTACGATGCAAAGAAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     361 TCGTTTCGGTGCCAGTGGCCTTCACCCACGACGTGGTGGTGGATTACGATGCAAAGAAGA 420


10001R-1.IR_full       421 ACATCACCTACGGCATGTGCACCTTCACGACGAACGACTTCCTTGGTCCGCGCACCTACC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10001R-1.in silico     421 ACATCACCTACGGCATGTGCACCTTCACGACGAACGACTTCCTTGGTCCGCGCACCTACC 480


10001R-1.IR_full       481 AGGTCACCTTCTTCATCAGC 500
                           ||||||||||||||||||||
10001R-1.in silico     481 AGGTCACCTTCTTCATCAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079820.2  CG10001-RA (AR-2), mRNA 
1.03   10  27  32  NM_166982.1  CG2872-RC, transcript variant C (AlstR), mRNA 
1.03   10  27  32  NM_079961.2  CG2872-RB, transcript variant B (AlstR), mRNA 
0   12  NM_078681.2  CG32540-RA (CCKLR-17D3), mRNA 
0   NM_132580.1  CG15729-RA (CG15729), mRNA 
0   NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
0   NM_140183.1  CG11799-RE, transcript variant E (Mnf), mRNA 
0   NM_168446.1  CG11799-RD, transcript variant D (Mnf), mRNA 
0   NM_168444.1  CG11799-RB, transcript variant B (Mnf), mRNA 
0   NM_168445.1  CG11799-RC, transcript variant C (Mnf), mRNA 
0   NM_001043138.1  CG17672-RA (CG17672), mRNA 
0   NM_168218.1  CG32372-RA (CG32372), mRNA 
0   10  NM_168778.1  CG3979-RB, transcript variant B (Indy), mRNA 
0   10  NM_168779.1  CG3979-RC, transcript variant C (Indy), mRNA 
0   10  NM_079426.2  CG3979-RA, transcript variant A (Indy), mRNA 
0   NM_078609.2  CG11654-RA (Ahcy13), mRNA 
0   NM_132429.2  CG2202-RA (CG2202), mRNA 
0   NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_143033.2  CG5807-RA (CG5807), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_205944.1  CG33298-RB, transcript variant B (CG33298), mRNA 
0   NM_205943.1  CG33298-RA, transcript variant A (CG33298), mRNA 
0   NM_140872.1  CG9330-RA (CG9330), mRNA 
0   10  NM_057951.2  CG9210-RA, transcript variant A (Ac13E), mRNA 
0   10  NM_001014745.1  CG9210-RB, transcript variant B (Ac13E), mRNA 
0   14  NM_132661.1  CG12726-RA (CG12726), mRNA 
0   NM_001014758.2  CG33517-RC, transcript variant C (D2R), mRNA 
0   NM_001014757.2  CG33517-RD, transcript variant D (D2R), mRNA 
0   NM_001014760.2  CG33517-RA, transcript variant A (D2R), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.