National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 29 April to 13 May, deadline 16 April.

KO Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 Stock ID M2L-3127 
 Knockout Gene CG18405 
 Genotype y[1]w[1118];CG18405[SK1] FRT 40A/CyO-Tb 
 gRNA ID 2LG-3018 
 gRNA sequence GGAGGCCACGAAGAACGGAC 
 Mutant sequence TTAGTGACAGCAACTACACGCTGGAGGCCAC-----------AGGCGGTGTGCCCCTACGATCCaCGTCACAACTCCACC -11 
 FRT40A intact?  
 Reference Bustillo ME, Douthit J, Astigarraga S, Treisman JE.<br> Two distinct mechanisms of Plexin A function in Drosophila optic lobe lamination and morphogenesis.<br> Development (2024) 151(10) [ PubMed ID = 38738602 ] [ RRC reference ]  
Gene
 CG No. CG18405 
 FlyBase ID  
 Symbol  
 Full Name  
 Synonym  
Pathways (updated: 2024/04/26)
 KEGG Pathway
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.