National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
KO Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 Stock ID M2L-0048 
 Knockout Gene CG16858 
 Genotype y[1]w[1118];CG16858[SK2] FRT 40A/CyO-Tb 
 gRNA ID 2LG-0035 
 gRNA sequence GACAAGGGTCTGCCCGGCGA 
 Mutant sequence CGGAGAGGTCGGTTTGCCCGGTGACAAGGGTCTGCtacaacy-----------TCGTTGGTCCTCCTGGTTCCCAGGGAC -11 
 FRT40A intact?  
 Reference  
Gene : FB_2016_05, released Sep 12, 2016 from gRNA
 CG No. CG16858 
 FlyBase ID FBgn0016075 
 Symbol vkg 
 Full Name viking 
 Synonym Coll IValpha2,6072, l(2)01209, alpha(IV)2/vkg, DmColA2, VkgC, coll. IV, col4a2,1209, CT25584, coll-IV, collagen-IV, type IV collagen, alpha-chain, type IV collagenS, Collagen IV, Type IV collagen, collagenIV a2, collagen IV, collagen IV alpha2 
Pathways (updated: 2024/04/26)
 KEGG Pathway dme04512 : ECM-receptor interaction
dme04820 : Cytoskeleton in muscle cells
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.