National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
KO Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 Stock ID M2L-0020 
 Knockout Gene CG14042 
 Genotype y[1]w[1118];CG14042[SK3] FRT 40A/CyO-Tb 
 gRNA ID 2LG-0012 
 gRNA sequence GCGAAACGGTGGGCGATCGTA 
 Mutant sequence TGCGCCTGCTGCAGGAGGTGGCCGAAACG-----------TAAGGCGCCACAGCGCCTGGCGGAGCAGCAGCTGGAGCAA -11 
 FRT40A intact?  
 Reference  
Gene : FB_2016_05, released Sep 12, 2016 from gRNA
 CG No. CG14042 
 FlyBase ID FBgn0260451 
 Symbol CG14042 
 Full Name  
 Synonym NEST:bs13e02, CG14041 
Pathways (updated: 2024/04/26)
 KEGG Pathway
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.