National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
KO Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 Stock ID M2L-0016 
 Knockout Gene CG10718 
 Genotype y[1]w[1118];CG10718[SK4] FRT 40A/CyO-Tb 
 gRNA ID 2LG-0009 
 gRNA sequence GGACCGCCGCACGATGAGGC 
 Mutant sequence GGATGACGCCGCTCTGGATGGCGGACCGCCGC----------GGGCATCATTCCACGCTTCTGCCACGAGCTATTCCGCC -10 
 FRT40A intact?  
 Reference  
Gene : FB_2016_05, released Sep 12, 2016 from gRNA
 CG No. CG10718 
 FlyBase ID FBgn0004374 
 Symbol neb 
 Full Name nebbish 
 Synonym KLP38B, Dm0332, DmKlp38B, sl(2)ry3, l(2)k07614, KLP 38B, Klp38, Mot, KIF14,38B.12, KLP-38B, tio, KIF 14, l(2)03552, l(2)k00802,38B.10, DmNeb, sl(2)ry, klp38B, Klp38B, nebb, Kinesin3C, tiovivo, Kinesin-like protein at 38B, Mothra 
Pathways (updated: 2024/04/26)
 KEGG Pathway dme04814 : Motor proteins
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.