National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
gRNA Stocks Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail
 Stock ID 2LG-0015 
 Genotype y[2] cho[1] v[1]; attP40{U6-gRNA}/CyO 
 gRNA sequence GGAGCCCTGAACGTCGTCGG 
 Landing Site attP40 
 Reference  
Gene : FB_2016_05, released Sep 12, 2016 
 CG No. CG7456 
 FlyBase ID FBgn0032258 
 Symbol CG7456 
 Full Name  
 Synonym Cog4 
Pathways (updated: 2024/04/26)
 KEGG Pathway
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.