Notice:
|
Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.
|
|
gRNA Stocks Detail |
Request : Click the "Order" button to request for this stock |
|
Stock Detail |
Stock ID |
2LG-0014 |
Genotype |
y[2] cho[1] v[1]; attP40{U6-gRNA}/CyO |
gRNA sequence |
GAACGCTGCGCCCGCCGATC |
Landing Site |
attP40 |
Reference |
|
Gene : FB_2016_05, released Sep 12, 2016
|
CG No. |
CG13391 |
FlyBase ID |
FBgn0027094 |
Symbol |
AlaRS |
Full Name |
Alanyl-tRNA synthetase |
Synonym |
alaS, Aats-ala, ARS |
|
|