National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

gRNA Stocks Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 Stock ID 2LG-0014 
 Genotype y[2] cho[1] v[1]; attP40{U6-gRNA}/CyO 
 gRNA sequence GAACGCTGCGCCCGCCGATC 
 Landing Site attP40 
 Reference  
Gene : FB_2016_05, released Sep 12, 2016 
 CG No. CG13391 
 FlyBase ID FBgn0027094 
 Symbol AlaRS 
 Full Name Alanyl-tRNA synthetase 
 Synonym alaS, Aats-ala, ARS 
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.