National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
gRNA Stocks Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail
 Stock ID 2LG-0031 
 Genotype y[2] cho[1] v[1]; attP40{U6-gRNA}/CyO 
 gRNA sequence GGAGCCATCCGCGGATTTGG 
 Landing Site attP40 
 Reference  
Gene : FB_2016_05, released Sep 12, 2016 
 CG No. CG3582 
 FlyBase ID FBgn0017457 
 Symbol U2af38 
 Full Name U2 small nuclear riboprotein auxiliary factor 38 
 Synonym DU2AF38, l(2)06751, dU2AF38, Utaf38, U2AF, dU2AF[38], U2AF 38 
SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.