|
Notice:
|
|
Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.
|
|
| gRNA Stocks Detail |
| Request : Click the "Order" button to request for this stock |
|
| Stock Detail |
| Stock ID |
2LG-0040 |
| Genotype |
y[2] cho[1] v[1]; attP40{U6-gRNA}/CyO |
| gRNA sequence |
GAGCGCGCCTGGCGCAAACAG |
| Landing Site |
attP40 |
| Reference |
Enli L, Moronuki Y, Yamada T, Kose H.
Examination of Niddm20 candidate genes of OLETF rats in Drosophila melanogaster using inducible GeneSwitch GAL4 system.
J Genet (2022) 101
[
PubMed ID = 35129134
]
[
RRC reference
]
|
|
Gene : FB_2016_05, released Sep 12, 2016
|
| CG No. |
CG13240 |
| FlyBase ID |
FBgn0001989 |
| Symbol |
ND-B17 |
| Full Name |
NADH dehydrogenase (ubiquinone) B17 subunit |
| Synonym |
BG:DS09217.1, NB7M, BcDNA:GM23292, l(2)35Di, NADH ubiquinone oxidoreductase B17, NADH-ubiquinone oxidoreductase B17 subunit, NADH:ubiquinone oxidoreductase B17 subunit, lethal (2) 35Di |
|
|
