|
Notice:
|
|
Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.
|
|
| gRNA Stocks Detail |
| Request : Click the "Order" button to request for this stock |
|
| Stock Detail |
| Stock ID |
2LG-0050 |
| Genotype |
y[2] cho[1] v[1]; attP40{U6-gRNA}/CyO |
| gRNA sequence |
GCGATTCACCATGTCCGCGT |
| Landing Site |
attP40 |
| Reference |
|
|
Gene : FB_2016_05, released Sep 12, 2016
|
| CG No. |
CG10158 |
| FlyBase ID |
FBgn0031871 |
| Symbol |
Fgop2 |
| Full Name |
Fibroblast growth factor receptor 1 oncogene partner 2 |
| Synonym |
FGFR1OP2, Fibroblast growth factor receptor 1 oncogene partner 2 ortholog |
|
|
