MG1655
W3110
Search for
  Japanese | English
Gene - Fasta Format
Fasta Format
    Download lpxC_nt.seq
    Gene name lpxC
    Length 918bp
    Fasta Format

>lpxC
atgatcaaacaaaggacacttaaacgtatcgttcaggcgacgggtgtcggtttacatacc
ggcaagaaagtcaccctgacgttacgccctgcgccggccaacaccggggtcatctatcgt
cgcaccgacttgaatccaccggtagatttcccggccgatgccaaatctgtgcgtgatacc
atgctctgtacgtgtctggtcaacgagcatgatgtacggatttcaaccgtagagcacctc
aatgctgctctcgcgggcttgggcatcgataacattgttatcgaagttaacgcgccggaa
atcccgatcatggacggcagcgccgctccgtttgtatacctgctgcttgacgccggtatc
gacgagttgaactgcgccaaaaaatttgttcgcatcaaagagactgttcgtgtcgaagat
ggcgataagtgggctgaatttaagccgtacaatggtttttcgctggatttcaccatcgat
tttaaccatccggctattgattccagcaaccagcgctatgcgatgaacttctccgctgat
gcgtttatgcgccagatcagccgtgcgcgtacgttcggtttcatgcgtgatatcgaatat
ctgcagtcccgtggtttgtgcctgggcggcagcttcgattgtgccatcgttgttgacgat
tatcgcgtactgaacgaagacggcctgcgttttgaagacgaatttgtgcgtcacaaaatg
ctcgatgcgatcggtgacttgttcatgtgtggtcacaatattattggtgcatttaccgct
tataaatccggtcatgcactgaataacaaactgctgcaggctgtcctggcgaaacaggaa
gcctgggaatatgtgaccttccaggacgacgcagaactgccgttggccttcaaagcgcct
tcagctgtactggcataa
						
    Fasta Format

View sequence in neighbor 100bp

>lpxC
gaattgactggaatttgggtttcgaggctctttgtgctaaactggcccgccgaatgtata
gtacacttcggttggataggtaatttggcgagataatacgatgatcaaacaaaggacact
taaacgtatcgttcaggcgacgggtgtcggtttacataccggcaagaaagtcaccctgac
gttacgccctgcgccggccaacaccggggtcatctatcgtcgcaccgacttgaatccacc
ggtagatttcccggccgatgccaaatctgtgcgtgataccatgctctgtacgtgtctggt
caacgagcatgatgtacggatttcaaccgtagagcacctcaatgctgctctcgcgggctt
gggcatcgataacattgttatcgaagttaacgcgccggaaatcccgatcatggacggcag
cgccgctccgtttgtatacctgctgcttgacgccggtatcgacgagttgaactgcgccaa
aaaatttgttcgcatcaaagagactgttcgtgtcgaagatggcgataagtgggctgaatt
taagccgtacaatggtttttcgctggatttcaccatcgattttaaccatccggctattga
ttccagcaaccagcgctatgcgatgaacttctccgctgatgcgtttatgcgccagatcag
ccgtgcgcgtacgttcggtttcatgcgtgatatcgaatatctgcagtcccgtggtttgtg
cctgggcggcagcttcgattgtgccatcgttgttgacgattatcgcgtactgaacgaaga
cggcctgcgttttgaagacgaatttgtgcgtcacaaaatgctcgatgcgatcggtgactt
gttcatgtgtggtcacaatattattggtgcatttaccgcttataaatccggtcatgcact
gaataacaaactgctgcaggctgtcctggcgaaacaggaagcctgggaatatgtgacctt
ccaggacgacgcagaactgccgttggccttcaaagcgccttcagctgtactggcataacg
acatttatactgtcgtataaaattcgactggcaaatctggcactctctccggccaggtga
accagtcgtttttttttgaattttataagagctataaa