MG1655
W3110
Search for
Japanese | English
Gene - Fasta Format
Fasta Format
    Download tff_nt.seq
    Gene name tff
    Length 136bp
    Fasta Format

>tff
cggacttccgatccatttcgtatacacagactggacggaagcgacaatctcactttgtgt
aacaacacacacgtatcggcacatattccggggtgccctttggggtcggtaatatgggat
acgtggaggcataacc
						
    Fasta Format

View sequence in neighbor 100bp

>tff
gccactgaaggttttctataatagaaaattcgacgtctgatgctgtacacagcgccaaca
attattggtgtccacgacgtatttgtggtataaagcgcgccggacttccgatccatttcg
tatacacagactggacggaagcgacaatctcactttgtgtaacaacacacacgtatcggc
acatattccggggtgccctttggggtcggtaatatgggatacgtggaggcataaccccaa
cttttatatagaggttttaatcatggcaactgtttccatgcgcgacatgctcaaggctgg
tgttcacttcggtcaccagacccgttactggaaccc